NM_005359.6:c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_005359.6(SMAD4):c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG(p.Gly471LeufsTer25) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G471G) has been classified as Likely benign.
Frequency
Consequence
NM_005359.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- juvenile polyposis/hereditary hemorrhagic telangiectasia syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, G2P, PanelApp Australia
- Myhre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
- generalized juvenile polyposis/juvenile polyposis coliInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- juvenile polyposis syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary hemorrhagic telangiectasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pulmonary arterial hypertensionInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005359.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMAD4 | NM_005359.6 | MANE Select | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | NP_005350.1 | ||
| SMAD4 | NM_001407041.1 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | NP_001393970.1 | |||
| SMAD4 | NM_001407042.1 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | NP_001393971.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMAD4 | ENST00000342988.8 | TSL:5 MANE Select | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | ENSP00000341551.3 | ||
| SMAD4 | ENST00000591126.5 | TSL:1 | n.3412_3436delGGCCCAGGATCAGTAGGTGGAATAG | non_coding_transcript_exon | Exon 7 of 8 | ||||
| SMAD4 | ENST00000714264.1 | c.1492_1516delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly498LeufsTer25 | frameshift | Exon 11 of 12 | ENSP00000519545.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at