chr18-51076739-TGGCCCAGGATCAGTAGGTGGAATAG-T
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The ENST00000342988.8(SMAD4):c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG(p.Gly471LeufsTer25) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G471G) has been classified as Likely benign.
Frequency
Consequence
ENST00000342988.8 frameshift
Scores
Clinical Significance
Conservation
Publications
- juvenile polyposis/hereditary hemorrhagic telangiectasia syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, G2P, PanelApp Australia
- Myhre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
- generalized juvenile polyposis/juvenile polyposis coliInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- juvenile polyposis syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary hemorrhagic telangiectasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pulmonary arterial hypertensionInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000342988.8. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMAD4 | NM_005359.6 | MANE Select | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | NP_005350.1 | ||
| SMAD4 | NM_001407041.1 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | NP_001393970.1 | |||
| SMAD4 | NM_001407042.1 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | NP_001393971.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMAD4 | ENST00000342988.8 | TSL:5 MANE Select | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift | Exon 11 of 12 | ENSP00000341551.3 | ||
| SMAD4 | ENST00000591126.5 | TSL:1 | n.3412_3436delGGCCCAGGATCAGTAGGTGGAATAG | non_coding_transcript_exon | Exon 7 of 8 | ||||
| SMAD4 | ENST00000714264.1 | c.1492_1516delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly498LeufsTer25 | frameshift | Exon 11 of 12 | ENSP00000519545.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at