NM_005859.5:c.126_146delCAGTGGCGGCGGCGGCGGCGG
Variant summary
Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_ModerateBS2
The NM_005859.5(PURA):c.126_146delCAGTGGCGGCGGCGGCGGCGG(p.Ser43_Gly49del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000262 in 1,105,442 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_005859.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -6 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PURA | NM_005859.5 | c.126_146delCAGTGGCGGCGGCGGCGGCGG | p.Ser43_Gly49del | disruptive_inframe_deletion | Exon 1 of 1 | ENST00000331327.5 | NP_005850.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| PURA | ENST00000331327.5 | c.126_146delCAGTGGCGGCGGCGGCGGCGG | p.Ser43_Gly49del | disruptive_inframe_deletion | Exon 1 of 1 | 6 | NM_005859.5 | ENSP00000332706.3 |
Frequencies
GnomAD3 genomes AF: 0.0000469 AC: 7AN: 149126Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.000140 AC: 1AN: 7138 AF XY: 0.000220 show subpopulations
GnomAD4 exome AF: 0.0000262 AC: 29AN: 1105442Hom.: 1 AF XY: 0.0000263 AC XY: 14AN XY: 531432 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000469 AC: 7AN: 149226Hom.: 0 Cov.: 31 AF XY: 0.0000549 AC XY: 4AN XY: 72828 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Submissions by phenotype
PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at