NM_006015.6:c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_006015.6(ARID1A):c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC(p.Ser11AlafsTer91) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000263 in 1,139,696 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_006015.6 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ARID1A | NM_006015.6 | c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC | p.Ser11AlafsTer91 | frameshift_variant | Exon 1 of 20 | ENST00000324856.13 | NP_006006.3 | |
ARID1A | NM_139135.4 | c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC | p.Ser11AlafsTer91 | frameshift_variant | Exon 1 of 20 | NP_624361.1 | ||
LOC124900417 | XM_047439473.1 | c.-42_-17delTTGCCCAGGCTGCTGGCGGCGGCGGG | upstream_gene_variant | XP_047295429.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ARID1A | ENST00000324856.13 | c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC | p.Ser11AlafsTer91 | frameshift_variant | Exon 1 of 20 | 1 | NM_006015.6 | ENSP00000320485.7 | ||
ARID1A | ENST00000457599.6 | c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC | p.Ser11AlafsTer91 | frameshift_variant | Exon 1 of 20 | 5 | ENSP00000387636.2 | |||
ARID1A | ENST00000430799.7 | c.-13+2817_-13+2842delAGCAGCCTGGGCAACCCGCCGCCGCC | intron_variant | Intron 1 of 19 | 5 | ENSP00000390317.3 | ||||
ARID1A | ENST00000637465.1 | c.-13+334_-13+359delAGCAGCCTGGGCAACCCGCCGCCGCC | intron_variant | Intron 1 of 2 | 5 | ENSP00000490650.1 |
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 148154Hom.: 0 Cov.: 31 FAILED QC
GnomAD4 exome AF: 0.00000263 AC: 3AN: 1139696Hom.: 0 AF XY: 0.00000542 AC XY: 3AN XY: 553350
GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 148250Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 72448
ClinVar
Submissions by phenotype
Intellectual disability, autosomal dominant 14 Pathogenic:3
PVS1, PS4_Moderate, PM2 -
- -
- -
Coffin-Siris syndrome 1 Pathogenic:1
The ARID1A c.31_56del (p.Ser11AlafsTer91) variant causes a shift in the protein reading frame that is predicted to result in premature termination of the protein. Loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay is expected. This variant has been reported in one individual with Coffin-Siris syndrome, in whom parental samples were unavailable to confirm the de novo status of the variant (PMID: 22426308; 25168959). The p.Ser11AlafsTer91 variant is not observed in version 2.1.1 or version 3.1.2 of the Genome Aggregation Database. This variant was identified in a de novo state. Based on the available evidence, the c.31_56del (p.Ser11AlafsTer91) variant is classified as pathogenic for Coffin-Siris syndrome. -
not provided Pathogenic:1
Identified in a patient with Coffin-Siris syndrome in the published literature (Tsurusaki et al., 2012; Kosho et al., 2014); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25168959, 24090879, 27082517, 22426308) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at