chr1-26696421-CCCCGCCGCCGCCAGCAGCCTGGGCAA-C
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_006015.6(ARID1A):c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC(p.Ser11AlafsTer91) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000263 in 1,139,696 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_006015.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- intellectual disability, autosomal dominant 14Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ARID1A | NM_006015.6 | c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC | p.Ser11AlafsTer91 | frameshift_variant | Exon 1 of 20 | ENST00000324856.13 | NP_006006.3 | |
| ARID1A | NM_139135.4 | c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC | p.Ser11AlafsTer91 | frameshift_variant | Exon 1 of 20 | NP_624361.1 | ||
| LOC124900417 | XM_047439473.1 | c.-42_-17delTTGCCCAGGCTGCTGGCGGCGGCGGG | upstream_gene_variant | XP_047295429.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 148154Hom.: 0 Cov.: 31
GnomAD4 exome AF: 0.00000263 AC: 3AN: 1139696Hom.: 0 AF XY: 0.00000542 AC XY: 3AN XY: 553350 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 148250Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 72448
ClinVar
Submissions by phenotype
Intellectual disability, autosomal dominant 14 Pathogenic:3
- -
- -
PVS1, PS4_Moderate, PM2 -
Coffin-Siris syndrome 1 Pathogenic:1
The ARID1A c.31_56del (p.Ser11AlafsTer91) variant causes a shift in the protein reading frame that is predicted to result in premature termination of the protein. Loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay is expected. This variant has been reported in one individual with Coffin-Siris syndrome, in whom parental samples were unavailable to confirm the de novo status of the variant (PMID: 22426308; 25168959). The p.Ser11AlafsTer91 variant is not observed in version 2.1.1 or version 3.1.2 of the Genome Aggregation Database. This variant was identified in a de novo state. Based on the available evidence, the c.31_56del (p.Ser11AlafsTer91) variant is classified as pathogenic for Coffin-Siris syndrome. -
not provided Pathogenic:1
Identified in a patient with Coffin-Siris syndrome in the published literature (Tsurusaki et al., 2012; Kosho et al., 2014); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25168959, 24090879, 27082517, 22426308) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at