NM_016373.4:c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2
The NM_016373.4(WWOX):c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC(p.Ala394AspfsTer124) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000186 in 1,614,060 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_016373.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
WWOX | NM_016373.4 | c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC | p.Ala394AspfsTer124 | frameshift_variant | Exon 9 of 9 | ENST00000566780.6 | NP_057457.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000131 AC: 2AN: 152176Hom.: 0 Cov.: 33
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461884Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727242
GnomAD4 genome AF: 0.0000131 AC: 2AN: 152176Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74334
ClinVar
Submissions by phenotype
Autosomal recessive spinocerebellar ataxia 12;C3463992:Developmental and epileptic encephalopathy, 1 Uncertain:1
This sequence change results in a frameshift in the WWOX gene (p.Ala394Aspfs*124). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 21 amino acid(s) of the WWOX protein and extend the protein by 102 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with WWOX-related conditions. ClinVar contains an entry for this variant (Variation ID: 410090). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at