chr16-79211728-ACGGCCCGGACCCTGTGGGCGCTCAGCGAGAGG-A

Variant names:

• chr16-79211728-ACGGCCCGGACCCTGTGGGCGCTCAGCGAGAGG-A
• rs1064792969
• NM_016373.4:c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_016373.4(WWOX):​c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC​(p.Ala394AspfsTer124) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000186 in 1,614,060 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T393T) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: WWOX NM_016373.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.25
• Publications: 0 publications found

Genes affected

WWOX (HGNC:12799): (WW domain containing oxidoreductase) This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

ENSG00000261722 (HGNC:):

MAF (HGNC:6776): (MAF bZIP transcription factor) The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]

MAF Gene-Disease associations (from GenCC):

• Ayme-Gripp syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• cataract 21 multiple types

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics
• cataract - microcornea syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• cerulean cataract

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pulverulent cataract

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fine-Lubinsky syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.053 CDS is truncated, and there are 1 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_016373.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WWOX	NM_016373.4	MANE Select	c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC	p.Ala394AspfsTer124	frameshift	Exon 9 of 9	NP_057457.1
	WWOX	NM_001291997.2		c.840_871delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC	p.Ala281AspfsTer124	frameshift	Exon 8 of 8	NP_001278926.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WWOX	ENST00000566780.6	TSL:1 MANE Select	c.1179_1210delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC	p.Ala394AspfsTer124	frameshift	Exon 9 of 9	ENSP00000457230.1
	WWOX	ENST00000402655.6	TSL:1	c.532_563delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC	p.Gly178fs	frameshift	Exon 5 of 5	ENSP00000384238.2
	WWOX	ENST00000406884.6	TSL:1	c.639_670delGGCCCGGACCCTGTGGGCGCTCAGCGAGAGGC	p.Ala214AspfsTer124	frameshift	Exon 6 of 6	ENSP00000384495.2

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152176 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461884 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727242

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1112006

Other (OTH) AF: 0.00 AC: 0 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152176 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74334

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41448

American (AMR) AF: 0.000131 AC: 2 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.00 AC: 0 AN: 4824

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10618

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68034

Other (OTH) AF: 0.00 AC: 0 AN: 2092

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00000000770867), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Autosomal recessive spinocerebellar ataxia 12;C3463992:Developmental and epileptic encephalopathy, 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=17/183	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792969; hg19: chr16-79245625;