NM_019066.5:c.1365_1385dupACCCGTGATCCGCCAGGCCCC

Variant names:

• chr15-23646357-G-GGGGGCCTGGCGGATCACGGGT
• rs794726941
• NM_019066.5:c.1365_1385dupACCCGTGATCCGCCAGGCCCC

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4 BS1_Supporting BS2

The NM_019066.5(MAGEL2):​c.1365_1385dupACCCGTGATCCGCCAGGCCCC​(p.Pro462_Ala463insProValIleArgGlnAlaPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000556 in 143,848 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000056 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000033 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MAGEL2 NM_019066.5 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 1.10

Genes affected

MAGEL2 (HGNC:6814): (MAGE family member L2) Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_019066.5.
• BS1: Variant frequency is greater than expected in population sas. gnomad4 allele frequency = 0.0000556 (8/143848) while in subpopulation SAS AF= 0.000451 (2/4430). AF 95% confidence interval is 0.0000799. There are 0 homozygotes in gnomad4. There are 4 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High AC in GnomAd4 at 8 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MAGEL2	NM_019066.5	c.1365_1385dupACCCGTGATCCGCCAGGCCCC	p.Pro462_Ala463insProValIleArgGlnAlaPro	disruptive_inframe_insertion	Exon 1 of 1	ENST00000650528.1	NP_061939.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MAGEL2	ENST00000650528.1	c.1365_1385dupACCCGTGATCCGCCAGGCCCC	p.Pro462_Ala463insProValIleArgGlnAlaPro	disruptive_inframe_insertion	Exon 1 of 1		NM_019066.5	ENSP00000497810.1

Frequencies

GnomAD3 genomes AF: 0.0000556 AC: 8 AN: 143778 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000784

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000451

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00365

Gnomad NFE AF: 0.0000306

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000327 AC: 40 AN: 1224066 Hom.: 0 Cov.: 32 AF XY: 0.0000337 AC XY: 20 AN XY: 592596

Gnomad4 AFR exome AF: 0.0000859

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000348

Gnomad4 SAS exome AF: 0.000246

Gnomad4 FIN exome AF: 0.0000343

Gnomad4 NFE exome AF: 0.0000199

Gnomad4 OTH exome AF: 0.0000593

GnomAD4 genome AF: 0.0000556 AC: 8 AN: 143848 Hom.: 0 Cov.: 32 AF XY: 0.0000570 AC XY: 4 AN XY: 70138

Gnomad4 AFR AF: 0.0000782

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000451

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000306

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:3

Jan 30, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1365_1385dup, results in the insertion of 7 amino acid(s) of the MAGEL2 protein (p.Pro456_Pro462dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MAGEL2-related conditions. ClinVar contains an entry for this variant (Variation ID: 2085056). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Feb 12, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 7 amino acids in a repetitive region with no known function; Has not been previously published as pathogenic or benign to our knowledge -

Sep 29, 2023

Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PM2, PM4 -

MAGEL2-related disorder Uncertain:1

Jul 03, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The MAGEL2 c.1365_1385dup21 variant is predicted to result in an in-frame duplication (p.Pro456_Pro462dup). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726941; hg19: chr15-23891504;