NM_025074.7:c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT

Variant names:

• chr4-78441296-AGGTACTACTTCCTGTAAAAC-T
• rs886037766
• NM_025074.7:c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_025074.7(FRAS1):​c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT​(p.Gly1889AsnfsTer4) variant causes a frameshift, splice donor, splice region, synonymous, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: FRAS1 NM_025074.7 frameshift, splice_donor, splice_region, synonymous, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.73
• Publications: 1 publications found

Genes affected

FRAS1 (HGNC:19185): (Fraser extracellular matrix complex subunit 1) This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

FRAS1 Gene-Disease associations (from GenCC):

• Fraser syndrome

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Fraser syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• renal agenesis, unilateral

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 4-78441296-AGGTACTACTTCCTGTAAAAC-T is Pathogenic according to our data. Variant chr4-78441296-AGGTACTACTTCCTGTAAAAC-T is described in ClinVar as [Pathogenic]. Clinvar id is 219183.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FRAS1	NM_025074.7	c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT	p.Gly1889AsnfsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant	Exon 41 of 74	ENST00000512123.4	NP_079350.5
FRAS1	NM_001166133.2	c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT	p.Gly1889AsnfsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant	Exon 41 of 42		NP_001159605.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FRAS1	ENST00000512123.4	c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT	p.Gly1889AsnfsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant	Exon 41 of 74	5	NM_025074.7	ENSP00000422834.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Fraser syndrome 1 Pathogenic:1

-

Centre for Genomic and Experimental Medicine, University of Edinburgh

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886037766; hg19: chr4-79362450;