chr4-78441296-AGGTACTACTTCCTGTAAAAC-T

Variant names:

• chr4-78441296-AGGTACTACTTCCTGTAAAAC-T
• rs886037766
• NM_025074.7:c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_025074.7(FRAS1):​c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT​(p.Gly1889AsnfsTer4) variant causes a frameshift, splice donor, splice region, synonymous, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: FRAS1 NM_025074.7 frameshift, splice_donor, splice_region, synonymous, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.73

Genes affected

FRAS1 (HGNC:19185): (Fraser extracellular matrix complex subunit 1) This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-78441296-AGGTACTACTTCCTGTAAAAC-T is Pathogenic according to our data. Variant chr4-78441296-AGGTACTACTTCCTGTAAAAC-T is described in ClinVar as [Pathogenic]. Clinvar id is 219183.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FRAS1	NM_025074.7	c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT	p.Gly1889AsnfsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant	Exon 41 of 74	ENST00000512123.4	NP_079350.5
FRAS1	NM_001166133.2	c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT	p.Gly1889AsnfsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant	Exon 41 of 42		NP_001159605.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FRAS1	ENST00000512123.4	c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT	p.Gly1889AsnfsTer4	frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant	Exon 41 of 74	5	NM_025074.7	ENSP00000422834.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Fraser syndrome 1 Pathogenic:1

-

Centre for Genomic and Experimental Medicine, University of Edinburgh

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs886037766; hg19: chr4-79362450;