rs886037766
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_025074.7(FRAS1):c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT(p.Gly1889AsnfsTer4) variant causes a frameshift, splice donor, splice region, synonymous, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_025074.7 frameshift, splice_donor, splice_region, synonymous, intron
Scores
Clinical Significance
Conservation
Publications
- Fraser syndromeInheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Fraser syndrome 1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- renal agenesis, unilateralInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
FRAS1 | NM_025074.7 | c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT | p.Gly1889AsnfsTer4 | frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant | Exon 41 of 74 | ENST00000512123.4 | NP_079350.5 | |
FRAS1 | NM_001166133.2 | c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT | p.Gly1889AsnfsTer4 | frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant | Exon 41 of 42 | NP_001159605.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
FRAS1 | ENST00000512123.4 | c.5664_5665+19delAGGTACTACTTCCTGTAAAACinsT | p.Gly1889AsnfsTer4 | frameshift_variant, splice_donor_variant, splice_region_variant, synonymous_variant, intron_variant | Exon 41 of 74 | 5 | NM_025074.7 | ENSP00000422834.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Fraser syndrome 1 Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at