NM_139058.3:c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG

Variant names:

Variant summary

Our verdict is The variant received 2 classification points (ACGS-UK Somatic Oncogenicity v2025). O3_SupportingO9_Supporting

The NM_139058.3(ARX):c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG (p.Gly143_Ala150del) variant causes a disruptive inframe deletion change. The variant results in an in-frame change. Note: allele frequency estimates from gnomAD may be inaccurate for this variant type (MNP or indel longer than 3 bp) due to technology limitations. The variant allele was found at a cumulative frequency of 0.0000176 (AC=14) in the gnomAD database across 794,928 control chromosomes, including 4 hemizygotes. The grpmax filtering allele frequency (95% CI) is 0.00002. Variant has been reported in ClinVar as Benign/Likely Benign (★★). The variant has been observed in cBioPortal in 1 sample across 1 study and 1 cancer type; somatic enrichment level: NONE (Observed in at most one deduplicated cBioPortal case.).

Frequency

Genomes: 𝑓 0.0000096 ( 0 hom., 0 hem., cov: 21)

Exomes 𝑓: 0.000019 ( 0 hom. 4 hem. )

Consequence

ARX
NM_139058.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2

Conservation

PhyloP100: 2.09

Publications

20 publications found

Variant links:

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

genetic developmental and epileptic encephalopathy
Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
X-linked complex neurodevelopmental disorder
Inheritance: XL Classification: DEFINITIVE Submitted by: G2P, ClinGen
developmental and epileptic encephalopathy, 1
Inheritance: XL Classification: STRONG Submitted by: PanelApp Australia
neurodevelopmental disorder
Inheritance: XL Classification: STRONG Submitted by: PanelApp Australia
X-linked lissencephaly with abnormal genitalia
Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
intellectual disability, X-linked, with or without seizures, ARX-related
Inheritance: XL Classification: MODERATE Submitted by: Ambry Genetics
corpus callosum agenesis-abnormal genitalia syndrome
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
infantile epileptic-dyskinetic encephalopathy
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
non-syndromic X-linked intellectual disability
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Partington syndrome
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
X-linked spasticity-intellectual disability-epilepsy syndrome
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ARX links:

Genome browser will be placed here

new If you want to explore the variant's impact on the transcript NM_139058.3, check out the Mutation Effect Viewer. This is especially useful for frameshift variants or if you want to visualize the effect of exon loss / intron retention.

Classification according to ACGS-UK Somatic Oncogenicity v2025

Classification was made for transcript:

Our verdict: Uncertain_significance. The variant received 2 points.

Show applied only (2)

Apply	Criterion Code & Title / Strength	Strength	Rationale / Clinical Context
	O3Absent or very rare in population		Very rare in gnomAD (popmax AF <0.01%) — O3 supporting; GnomAD effective popmax AF = 0.000020 — very rare (O3 supporting [+1])
	O9Protein length change in non-repeat region		In-frame indel in non-repetitive region, gene type unknown (O9 supporting); In-frame indel in non-repetitive region — gene: unknown gene type

Variant Effect in Transcripts

Automated classification analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated classification assignments.

RefSeq Transcripts

Sel.	Gene / Transcript	Tags	HGVSc / HGVSp	Effect	Exon rank	Protein / UniProt
	ARX NM_139058.3	MANE Select	c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG p.Gly143_Ala150del	disruptive_inframe_deletion	Exon 2 of 5	Prot: NP_620689.1 UniProt: Q96QS3

ARX NM_139058.3

MANE Select

HGVSc / HGVSpc.428_451delGGGCCGCCGCGGCAGCCGCGGCCGp.Gly143_Ala150del

Exon rankExon 2 of 5

disruptive_inframe_deletion

Prot: NP_620689.1UniProt: Q96QS3

Ensembl Transcripts

Sel.	Gene / Transcript	Tags	HGVSc / HGVSp	Effect	Exon rank	Protein / UniProt
	ARX ENST00000379044.5	TSL:1MANE Select	c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG p.Gly143_Ala150del	disruptive_inframe_deletion	Exon 2 of 5	Prot: ENSP00000368332.4 UniProt: Q96QS3

ARX ENST00000379044.5

TSL:1MANE Select

HGVSc / HGVSpc.428_451delGGGCCGCCGCGGCAGCCGCGGCCGp.Gly143_Ala150del

Exon rankExon 2 of 5

disruptive_inframe_deletion

Prot: ENSP00000368332.4UniProt: Q96QS3

Frequencies

Allele frequencies (AF), counts (AC/AN), homozygotes and coverage

Common (AF > 0.05 / Hom > 5)

Rare (AF ≤ 0.0001 / Hom ≤ 1)

Source / population	AF	AC	Hom	AN	Coverage
Global population databases 5 sources Large-scale international reference populations
GnomAD3 genomes	AF: 0.00000959	AC:1	Hom:0	AN:104289	Cov:21
GnomAD4 exome	AF: 0.0000188	AC:13	Hom:0	AN:690639	Cov:
GnomAD4 genome	AF: 0.00000959	AC:1	Hom:0	AN:104289	Cov:21
TOPMed (Bravo)	AF: 0.0000189	AC:5	Hom:2	AN:264690	Cov:
ALFA (dbGaP/dbSNP Allele Frequency Aggregator)	AF: 0.000102	AC:2	Hom:1	AN:19648	Cov:

Showing 5 sources

ClinVar

ClinVar submissions

Significance:Benign/Likely benign

Revision:criteria provided, multiple submitters, no conflicts

View on ClinVar

Pathogenic

VUS

Benign

Condition

Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 (1)

not provided (1)

Computational Scores

Algorithm	Calibrated pred.	Score	Prediction
PhyloP100	Benign	2.1

Showing 1 of 1 scores

Splicing Scores

No splicing scores have been computed for this variant.

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

MaveDB functional evidence

MaveDB is a public repository of laboratory assays that test the effect of thousands of variants at once — treat this as supporting research data and interpret it with great caution; it is not a clinical classification.

No MaveDB functional evidence found for this variant.

Publications

You must be logged in to view publications. This limit was set because tens of millions (!) of queries from AI bots are generated daily.

Variant summary

Frequency

Consequence

Scores

Clinical Significance

Conservation

Publications

Classification according to ACGS-UK Somatic Oncogenicity v2025

Variant Effect in Transcripts

RefSeq Transcripts

Ensembl Transcripts

Frequencies

ClinVar

Computational Scores

Splicing Scores

MaveDB functional evidence ?

Publications

Other links and lift over

MaveDB functional evidence