NM_213599.3:c.1693_1715delTTTGTAAATTTTTACTCATCCTG
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_213599.3(ANO5):c.1693_1715delTTTGTAAATTTTTACTCATCCTG(p.Phe565LeufsTer7) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. F565F) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_213599.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive limb-girdle muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- gnathodiaphyseal dysplasiaInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- autosomal recessive limb-girdle muscular dystrophy type 2LInheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- Miyoshi muscular dystrophy 3Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ANO5 | NM_213599.3 | c.1693_1715delTTTGTAAATTTTTACTCATCCTG | p.Phe565LeufsTer7 | frameshift_variant | Exon 16 of 22 | ENST00000324559.9 | NP_998764.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ANO5 | ENST00000324559.9 | c.1693_1715delTTTGTAAATTTTTACTCATCCTG | p.Phe565LeufsTer7 | frameshift_variant | Exon 16 of 22 | 1 | NM_213599.3 | ENSP00000315371.9 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Miyoshi muscular dystrophy 3 Uncertain:1
- -
Gnathodiaphyseal dysplasia Uncertain:1
- -
Autosomal recessive limb-girdle muscular dystrophy type 2L Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at