X-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G

Variant names:

• chrX-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G
• rs879255567
• NM_000032.5:c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_Moderate PM2 PP5

The NM_000032.5(ALAS2):​c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG​(p.Ser551ProfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 22)
• Consequence: ALAS2 NM_000032.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.32

Genes affected

ALAS2 (HGNC:397): (5'-aminolevulinate synthase 2) The product of this gene specifies an erythroid-specific mitochondrially located enzyme. The encoded protein catalyzes the first step in the heme biosynthetic pathway. Defects in this gene cause X-linked pyridoxine-responsive sideroblastic anemia. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

APEX2 (HGNC:17889): (apurinic/apyrimidinic endodeoxyribonuclease 2) Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0641 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G is Pathogenic according to our data. Variant chrX-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 60674.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ALAS2	NM_000032.5	c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser551ProfsTer6	frameshift_variant	Exon 11 of 11	ENST00000650242.1	NP_000023.2
APEX2	NM_014481.4	c.*1833_*1858delCGACAGAAATTGCAGGCAGCCACAGA		downstream_gene_variant		ENST00000374987.4	NP_055296.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ALAS2	ENST00000650242.1	c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser551ProfsTer6	frameshift_variant	Exon 11 of 11		NM_000032.5	ENSP00000497236.1
APEX2	ENST00000374987.4	c.*1833_*1858delCGACAGAAATTGCAGGCAGCCACAGA		downstream_gene_variant		1	NM_014481.4	ENSP00000364126.3

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

X-linked erythropoietic protoporphyria Pathogenic:1

Apr 01, 2013

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879255567; hg19: chrX-55035700;