rs879255567
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_StrongPP5
The NM_000032.5(ALAS2):c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG(p.Ser551ProfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_000032.5 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000032.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ALAS2 | NM_000032.5 | MANE Select | c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG | p.Ser551ProfsTer6 | frameshift | Exon 11 of 11 | NP_000023.2 | P22557-1 | |
| ALAS2 | NM_001037968.4 | c.1612_1637delTCTGTGGCTGCCTGCAATTTCTGTCG | p.Ser538ProfsTer6 | frameshift | Exon 11 of 11 | NP_001033057.1 | P22557-4 | ||
| ALAS2 | NM_001037967.4 | c.1540_1565delTCTGTGGCTGCCTGCAATTTCTGTCG | p.Ser514ProfsTer6 | frameshift | Exon 10 of 10 | NP_001033056.1 | P22557-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ALAS2 | ENST00000650242.1 | MANE Select | c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG | p.Ser551ProfsTer6 | frameshift | Exon 11 of 11 | ENSP00000497236.1 | P22557-1 | |
| ALAS2 | ENST00000396198.7 | TSL:5 | c.1612_1637delTCTGTGGCTGCCTGCAATTTCTGTCG | p.Ser538ProfsTer6 | frameshift | Exon 11 of 11 | ENSP00000379501.3 | P22557-4 | |
| ALAS2 | ENST00000335854.8 | TSL:2 | c.1540_1565delTCTGTGGCTGCCTGCAATTTCTGTCG | p.Ser514ProfsTer6 | frameshift | Exon 10 of 10 | ENSP00000337131.4 | P22557-2 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at