chrX-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G

Variant names:

• chrX-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G
• rs879255567
• NM_000032.5:c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The NM_000032.5(ALAS2):​c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG​(p.Ser551ProfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 22)
• Consequence: ALAS2 NM_000032.5 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 9.32
• Publications: 2 publications found

Genes affected

ALAS2 (HGNC:397): (5'-aminolevulinate synthase 2) The product of this gene specifies an erythroid-specific mitochondrially located enzyme. The encoded protein catalyzes the first step in the heme biosynthetic pathway. Defects in this gene cause X-linked pyridoxine-responsive sideroblastic anemia. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

APEX2 (HGNC:17889): (apurinic/apyrimidinic endodeoxyribonuclease 2) Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 8 pathogenic variants in the truncated region.
• PP5: Variant X-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G is Pathogenic according to our data. Variant chrX-55009267-GCGACAGAAATTGCAGGCAGCCACAGA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 60674.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000032.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALAS2	NM_000032.5	MANE Select	c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser551ProfsTer6	frameshift	Exon 11 of 11	NP_000023.2	P22557-1
	ALAS2	NM_001037968.4		c.1612_1637delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser538ProfsTer6	frameshift	Exon 11 of 11	NP_001033057.1	P22557-4
	ALAS2	NM_001037967.4		c.1540_1565delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser514ProfsTer6	frameshift	Exon 10 of 10	NP_001033056.1	P22557-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ALAS2	ENST00000650242.1	MANE Select	c.1651_1676delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser551ProfsTer6	frameshift	Exon 11 of 11	ENSP00000497236.1	P22557-1
	ALAS2	ENST00000396198.7	TSL:5	c.1612_1637delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser538ProfsTer6	frameshift	Exon 11 of 11	ENSP00000379501.3	P22557-4
	ALAS2	ENST00000335854.8	TSL:2	c.1540_1565delTCTGTGGCTGCCTGCAATTTCTGTCG	p.Ser514ProfsTer6	frameshift	Exon 10 of 10	ENSP00000337131.4	P22557-2

Frequencies

GnomAD3 genomes Cov.: 22

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	X-linked erythropoietic protoporphyria (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=15/185	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs879255567; hg19: chrX-55035700;