X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chrX-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_000044.6(AR):​c.225_239dupGCAGCAGCAGCAGCA​(p.Gln76_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.020 (36 hom., 74 hem., cov: 0)
  • Exomes 𝑓: 0.0067 (10 hom. 419 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.337

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCA is described in ClinVar as [Benign]. Clinvar id is 464795.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.0196 (1304/66608) while in subpopulation EAS AF= 0.0402 (74/1841). AF 95% confidence interval is 0.0328. There are 36 homozygotes in gnomad4. There are 74 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 36 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AR	NM_000044.6	c.225_239dupGCAGCAGCAGCAGCA	p.Gln76_Gln80dup	disruptive_inframe_insertion	1/8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.225_239dupGCAGCAGCAGCAGCA	p.Gln76_Gln80dup	disruptive_inframe_insertion	1/8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.0196 AC: 1304 AN: 66621 Hom.: 36 Cov.: 0 AF XY: 0.00898 AC XY: 74 AN XY: 8243

Gnomad AFR AF: 0.0118

Gnomad AMI AF: 0.0112

Gnomad AMR AF: 0.0251

Gnomad ASJ AF: 0.0274

Gnomad EAS AF: 0.0400

Gnomad SAS AF: 0.0263

Gnomad FIN AF: 0.0222

Gnomad MID AF: 0.0327

Gnomad NFE AF: 0.0213

Gnomad OTH AF: 0.0150

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00673 AC: 6273 AN: 932512 Hom.: 10 Cov.: 40 AF XY: 0.00144 AC XY: 419 AN XY: 290870

Gnomad4 AFR exome AF: 0.00380

Gnomad4 AMR exome AF: 0.0141

Gnomad4 ASJ exome AF: 0.0132

Gnomad4 EAS exome AF: 0.0262

Gnomad4 SAS exome AF: 0.00757

Gnomad4 FIN exome AF: 0.0180

Gnomad4 NFE exome AF: 0.00491

Gnomad4 OTH exome AF: 0.00895

GnomAD4 genome AF: 0.0196 AC: 1304 AN: 66608 Hom.: 36 Cov.: 0 AF XY: 0.00896 AC XY: 74 AN XY: 8256

Gnomad4 AFR AF: 0.0118

Gnomad4 AMR AF: 0.0250

Gnomad4 ASJ AF: 0.0274

Gnomad4 EAS AF: 0.0402

Gnomad4 SAS AF: 0.0266

Gnomad4 FIN AF: 0.0222

Gnomad4 NFE AF: 0.0213

Gnomad4 OTH AF: 0.0148

ClinVar

Significance: Benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Likely benign, no assertion criteria provided	clinical testing	Department of Pathology and Laboratory Medicine, Sinai Health System	-	The AR p.Gln76_Gln80dup variant was not identified in the literature nor was it identified in the dbSNP, COGR, Cosmic, MutDB, and UMD-LSDB databases. The variant was also identified in ClinVar as benign with one submission from Invitae with the associated conditions of Androgen resistance syndrome and Bulbo-spinal atrophy X-linked. The variant was also identified in LOVD 3.0. The variant was not identified in the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). This variant is an in-frame insertion resulting in the duplication of a glutamine (gln) residue at codon 76; the impact of this alteration on AR protein function is not known, however this insertion occurs in a variable poly-Q repeat region and was predicted to be a polymorphism by MutationTaster. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time although we would lean towards a more benign role for this variant. This variant is classified as likely benign. -
Benign, criteria provided, single submitter	clinical testing	GeneDx	Jul 06, 2016	- -

not specified Benign:1

Benign, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Jul 25, 2023

Variant summary: AR c.225_239dup15 (p.Gln76_Gln80dup) results in an in-frame duplication that is predicted to duplicate five amino acids into the encoded protein. Diagnosis of Spinal and bulbar muscular atrophy is established based on the identification of an expansion of CAG trinucleotide repeat of >35 CAGs whereas the current variant involves 28 CAGs. Additionally, this in-frame duplication is not consistent with the molecular mechanism of disease for Androgen Resistance Syndrome. The variant was absent in 166414 control chromosomes, however this region of the gene in gnomad contains numerous high frequency duplications/deletions, with dubious quality annotation due to low complexity region. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. c.225_239dup15 has been reported in the literature in an individual affected with Hypospadias (Xie_2012). These data do not allow any conclusion about variant significance. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication have been ascertained in the context of this evaluation (PMID: 35729303). Two submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. All submitters classified the variant as benign. Based on the evidence outlined above, the variant was classified as benign. -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 29, 2025

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;