chr1-21850423-TGCCCAACACTCGGCACACGTACTC-T
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_005529.7(HSPG2):c.7210_7233delGAGTACGTGTGCCGAGTGTTGGGC(p.Glu2404_Gly2411del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000155 in 1,612,044 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_005529.7 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Schwartz-Jampel syndrome type 1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
- Silverman-Handmaker type dyssegmental dysplasiaInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae), G2P
- Schwartz-Jampel syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005529.7. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HSPG2 | MANE Select | c.7210_7233delGAGTACGTGTGCCGAGTGTTGGGC | p.Glu2404_Gly2411del | conservative_inframe_deletion | Exon 56 of 97 | NP_005520.4 | |||
| HSPG2 | c.7213_7236delGAGTACGTGTGCCGAGTGTTGGGC | p.Glu2405_Gly2412del | conservative_inframe_deletion | Exon 56 of 97 | NP_001278789.1 |
Frequencies
GnomAD3 genomes AF: 0.0000920 AC: 14AN: 152164Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.0000733 AC: 18AN: 245698 AF XY: 0.0000899 show subpopulations
GnomAD4 exome AF: 0.000162 AC: 236AN: 1459880Hom.: 0 AF XY: 0.000160 AC XY: 116AN XY: 726142 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000920 AC: 14AN: 152164Hom.: 0 Cov.: 33 AF XY: 0.0000673 AC XY: 5AN XY: 74336 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at