chr11-1017469-TGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTC-T

Position:

• chr11-1017469-TGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTC-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1

The NM_005961.3(MUC6):​c.5196_5331del​(p.Thr1733ProfsTer71) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000043 (0 hom., cov: 118)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MUC6 NM_005961.3 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.0120

Genes affected

MUC6 (HGNC:7517): (mucin 6, oligomeric mucus/gel-forming) This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MUC6	NM_005961.3	c.5196_5331del	p.Thr1733ProfsTer71	frameshift_variant	31/33	ENST00000421673.7	NP_005952.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MUC6	ENST00000421673.7	c.5196_5331del	p.Thr1733ProfsTer71	frameshift_variant	31/33	5	NM_005961.3	ENSP00000406861	P1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 6 AN: 140860 Hom.: 0 Cov.: 118 FAILED QC

Gnomad AFR AF: 0.0000514

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000706

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000201

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000160

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 1342074 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 661764

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000426 AC: 6 AN: 140972 Hom.: 0 Cov.: 118 AF XY: 0.0000578 AC XY: 4 AN XY: 69150

Gnomad4 AFR AF: 0.0000513

Gnomad4 AMR AF: 0.0000705

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000201

Gnomad4 NFE AF: 0.0000161

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Lung cancer Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-1017469;