chr11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT
Variant summary
Our verdict is Pathogenic. The variant received 14 ACMG points: 14P and 0B. PVS1PS3PP5_Moderate
The NM_001370259.2(MEN1):c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG(p.Glu469ArgfsTer98) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV000541234: Experimental studies have shown that disruption of this region abrogates the ability of MEN1 to bind DNA, regulate target gene expression, and inhibit cell proliferation (PMID:15331604, 16449969).". Synonymous variant affecting the same amino acid position (i.e. E468E) has been classified as Likely benign.
Frequency
Consequence
NM_001370259.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- multiple endocrine neoplasia type 1Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- familial isolated hyperparathyroidismInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pituitary gigantismInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 14 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001370259.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MEN1 | MANE Select | c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu469ArgfsTer98 | frameshift | Exon 10 of 10 | NP_001357188.2 | O00255-2 | ||
| MEN1 | c.1523_1545dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu516ArgfsTer98 | frameshift | Exon 11 of 11 | NP_001394079.1 | ||||
| MEN1 | c.1508_1530dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu511ArgfsTer98 | frameshift | Exon 11 of 11 | NP_001357180.2 | A0A5F9ZHS3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MEN1 | TSL:5 MANE Select | c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu469ArgfsTer98 | frameshift | Exon 10 of 10 | ENSP00000394933.3 | O00255-2 | ||
| MEN1 | TSL:1 | c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu469ArgfsTer98 | frameshift | Exon 10 of 10 | ENSP00000308975.6 | O00255-2 | ||
| MEN1 | TSL:1 | c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu469ArgfsTer98 | frameshift | Exon 11 of 11 | ENSP00000388016.2 | O00255-2 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 exome Cov.: 43
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at