rs1555163780
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001370259.2(MEN1):c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG(p.Glu469ArgfsTer98) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. E468E) has been classified as Likely benign.
Frequency
Consequence
NM_001370259.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- multiple endocrine neoplasia type 1Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet, Ambry Genetics
- familial isolated hyperparathyroidismInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pituitary gigantismInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary pheochromocytoma-paragangliomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MEN1 | NM_001370259.2 | c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu469ArgfsTer98 | frameshift_variant | Exon 10 of 10 | ENST00000450708.7 | NP_001357188.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MEN1 | ENST00000450708.7 | c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG | p.Glu469ArgfsTer98 | frameshift_variant | Exon 10 of 10 | 5 | NM_001370259.2 | ENSP00000394933.3 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 exome Cov.: 43
GnomAD4 genome Cov.: 34
ClinVar
Submissions by phenotype
Multiple endocrine neoplasia, type 1 Pathogenic:1
This sequence change inserts 23 nucleotides in exon 10 of the MEN1 mRNA (c.1382_1404dup), causing a frameshift at codon 469. This creates a premature translational stop signal in the last exon of the MEN1 mRNA (p.Glu469Argfs*98). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated MEN1 protein, eliminating 142 C-terminal amino acid residues. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a MEN1-related disease. In summary, this is a novel variant that truncates an important functional domain in MEN1. For this reason, it has been classified as Pathogenic. This frameshift truncates the functionally conserved nuclear localization signal of the MEN1 protein. Experimental studies have shown that disruption of this region abrogates the ability of MEN1 to bind DNA, regulate target gene expression, and inhibit cell proliferation (PMID: 15331604, 16449969). In addition, a different frameshift variant (p.Arg516Glyfs*43) with a premature termination codon downstream of this frameshift has been reported to be a common cause of multiple endocrine neoplasia type 1 (PMID: 17879353) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at