rs1555163780

Variant names:

• chr11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT
• rs1555163780
• NM_001370259.2:c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG

Variant summary

Our verdict is Pathogenic. The variant received 14 ACMG points: 14P and 0B. PVS1 PS3 PP5_Moderate

The NM_001370259.2(MEN1):​c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG​(p.Glu469ArgfsTer98) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV000541234: Experimental studies have shown that disruption of this region abrogates the ability of MEN1 to bind DNA, regulate target gene expression, and inhibit cell proliferation (PMID:15331604, 16449969).". Synonymous variant affecting the same amino acid position (i.e. E468E) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 34)
• Consequence: MEN1 NM_001370259.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.251
• Publications: 0 publications found

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

MEN1 Gene-Disease associations (from GenCC):

• multiple endocrine neoplasia type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• familial isolated hyperparathyroidism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 89 pathogenic variants in the truncated region.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000541234: Experimental studies have shown that disruption of this region abrogates the ability of MEN1 to bind DNA, regulate target gene expression, and inhibit cell proliferation (PMID: 15331604, 16449969).
• PP5: Variant 11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT is Pathogenic according to our data. Variant chr11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT is described in ClinVar as Pathogenic. ClinVar VariationId is 403843.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001370259.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MEN1	NM_001370259.2	MANE Select	c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu469ArgfsTer98	frameshift	Exon 10 of 10	NP_001357188.2	O00255-2
	MEN1	NM_001407150.1		c.1523_1545dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu516ArgfsTer98	frameshift	Exon 11 of 11	NP_001394079.1
	MEN1	NM_001370251.2		c.1508_1530dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu511ArgfsTer98	frameshift	Exon 11 of 11	NP_001357180.2	A0A5F9ZHS3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MEN1	ENST00000450708.7	TSL:5 MANE Select	c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu469ArgfsTer98	frameshift	Exon 10 of 10	ENSP00000394933.3	O00255-2
	MEN1	ENST00000312049.11	TSL:1	c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu469ArgfsTer98	frameshift	Exon 10 of 10	ENSP00000308975.6	O00255-2
	MEN1	ENST00000424912.2	TSL:1	c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu469ArgfsTer98	frameshift	Exon 11 of 11	ENSP00000388016.2	O00255-2

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 43

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Multiple endocrine neoplasia, type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.25
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555163780; hg19: chr11-64572234;