chr13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA

Position:

• chr13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_000321.3(RB1):​c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA​(p.Thr345fs) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RB1 NM_000321.3 frameshift, stop_gained
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.79

Genes affected

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

LOC112268118 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA is Pathogenic according to our data. Variant chr13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA is described in ClinVar as [Pathogenic]. Clinvar id is 13081.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RB1	NM_000321.3	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345fs	frameshift_variant, stop_gained	10/27	ENST00000267163.6	NP_000312.2
RB1	NM_001407165.1	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345fs	frameshift_variant, stop_gained	10/27		NP_001394094.1
RB1	NM_001407166.1	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345fs	frameshift_variant, stop_gained	10/17		NP_001394095.1
LOC112268118	XR_002957522.2	n.122-2611_122-2557dupTCTGAAGAGTTTTATCATGATCCAAAAATAATCTTGCATCTAGATCTTTATTTTT		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RB1	ENST00000267163.6	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345fs	frameshift_variant, stop_gained	10/27	1	NM_000321.3	ENSP00000267163.4
RB1	ENST00000650461.1	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345fs	frameshift_variant, stop_gained	10/27			ENSP00000497193.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Retinoblastoma Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Nov 01, 1989

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555285429; hg19: chr13-48941668;