rs1555285429

Variant names:

• chr13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA
• rs1555285429
• NM_000321.3:c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_000321.3(RB1):​c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA​(p.Thr345LysfsTer3) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. T345T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RB1 NM_000321.3 frameshift, stop_gained
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.79
• Publications: 0 publications found

Genes affected

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

RB1 Gene-Disease associations (from GenCC):

• hereditary retinoblastoma

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P, Ambry Genetics
• retinoblastoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• melanoma

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

LOC112268118 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA is Pathogenic according to our data. Variant chr13-48367532-T-TAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA is described in ClinVar as Pathogenic. ClinVar VariationId is 13081.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000321.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1	NM_000321.3	MANE Select	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345LysfsTer3	frameshift stop_gained	Exon 10 of 27	NP_000312.2
	RB1	NM_001407165.1		c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345LysfsTer3	frameshift stop_gained	Exon 10 of 27	NP_001394094.1
	RB1	NM_001407166.1		c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345LysfsTer3	frameshift stop_gained	Exon 10 of 17	NP_001394095.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1	ENST00000267163.6	TSL:1 MANE Select	c.979_1033dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA	p.Thr345LysfsTer3	frameshift stop_gained	Exon 10 of 27	ENSP00000267163.4
	RB1	ENST00000467505.6	TSL:1	n.*347_*401dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA		non_coding_transcript_exon	Exon 5 of 22	ENSP00000434702.1
	RB1	ENST00000467505.6	TSL:1	n.*347_*401dupAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGA		3_prime_UTR	Exon 5 of 22	ENSP00000434702.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Retinoblastoma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555285429; hg19: chr13-48941668;