chr14-23424083-C-CCAGCTGAATCTTGTTTTTGAT

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1PM2PM4

The NM_000257.4(MYH7):​c.2725_2745dupATCAAAAACAAGATTCAGCTG​(p.Leu915_Glu916insIleLysAsnLysIleGlnLeu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

MYH7
NM_000257.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:2

Conservation

PhyloP100: 1.42
Variant links:
Genes affected
MYH7 (HGNC:7577): (myosin heavy chain 7) Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing distal myopathy. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PM1
In a helix (size 120) in uniprot entity MYH7_HUMAN there are 91 pathogenic changes around while only 3 benign (97%) in NM_000257.4
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000257.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYH7NM_000257.4 linkc.2725_2745dupATCAAAAACAAGATTCAGCTG p.Leu915_Glu916insIleLysAsnLysIleGlnLeu conservative_inframe_insertion Exon 23 of 40 ENST00000355349.4 NP_000248.2 P12883
MYH7NM_001407004.1 linkc.2725_2745dupATCAAAAACAAGATTCAGCTG p.Leu915_Glu916insIleLysAsnLysIleGlnLeu conservative_inframe_insertion Exon 22 of 39 NP_001393933.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYH7ENST00000355349.4 linkc.2725_2745dupATCAAAAACAAGATTCAGCTG p.Leu915_Glu916insIleLysAsnLysIleGlnLeu conservative_inframe_insertion Exon 23 of 40 1 NM_000257.4 ENSP00000347507.3 P12883

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
34
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Uncertain:1
Mar 01, 2021
Revvity Omics, Revvity
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Hypertrophic cardiomyopathy Uncertain:1
Jun 20, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

ClinVar contains an entry for this variant (Variation ID: 454362). This variant, c.2725_2745dup, results in the insertion of 7 amino acid(s) of the MYH7 protein (p.Ile909_Leu915dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYH7-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555337594; hg19: chr14-23893292; API