rs1555337594
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1PM2PM4
The NM_000257.4(MYH7):c.2725_2745dupATCAAAAACAAGATTCAGCTG(p.Leu915_Glu916insIleLysAsnLysIleGlnLeu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000257.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MYH7 | NM_000257.4 | c.2725_2745dupATCAAAAACAAGATTCAGCTG | p.Leu915_Glu916insIleLysAsnLysIleGlnLeu | conservative_inframe_insertion | Exon 23 of 40 | ENST00000355349.4 | NP_000248.2 | |
MYH7 | NM_001407004.1 | c.2725_2745dupATCAAAAACAAGATTCAGCTG | p.Leu915_Glu916insIleLysAsnLysIleGlnLeu | conservative_inframe_insertion | Exon 22 of 39 | NP_001393933.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 34
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
- -
Hypertrophic cardiomyopathy Uncertain:1
ClinVar contains an entry for this variant (Variation ID: 454362). This variant, c.2725_2745dup, results in the insertion of 7 amino acid(s) of the MYH7 protein (p.Ile909_Leu915dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MYH7-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at