chr14-44504920-TCTCCTCAGCTGGTAGAGACTGAACTTCAGCAGGGGC-T

Variant names:

• chr14-44504920-TCTCCTCAGCTGGTAGAGACTGAACTTCAGCAGGGGC-T
• rs866319674
• NM_032135.4:c.2032_2067delGCCCCTGCTGAAGTTCAGTCTCTACCAGCTGAGGAG

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_032135.4(FSCB):​c.2032_2067delGCCCCTGCTGAAGTTCAGTCTCTACCAGCTGAGGAG​(p.Ala678_Glu689del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0061 in 150,608 control chromosomes in the GnomAD database, including 46 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0061 (46 hom., cov: 32)
  • Exomes 𝑓: 0.00032 (28 hom.)
  • Failed GnomAD Quality Control
• Consequence: FSCB NM_032135.4 conservative_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.43
• Publications: 0 publications found

Genes affected

FSCB (HGNC:20494): (fibrous sheath CABYR binding protein) Predicted to enable calcium ion binding activity. Predicted to be involved in negative regulation of protein sumoylation. Predicted to be active in sperm fibrous sheath and sperm principal piece. [provided by Alliance of Genome Resources, Apr 2022]

LINC02277 (HGNC:53193): (long intergenic non-protein coding RNA 2277)

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_032135.4.
• BP6: Variant 14-44504920-TCTCCTCAGCTGGTAGAGACTGAACTTCAGCAGGGGC-T is Benign according to our data. Variant chr14-44504920-TCTCCTCAGCTGGTAGAGACTGAACTTCAGCAGGGGC-T is described in ClinVar as Likely_benign. ClinVar VariationId is 776832.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 46 Unknown gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_032135.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FSCB	NM_032135.4	MANE Select	c.2032_2067delGCCCCTGCTGAAGTTCAGTCTCTACCAGCTGAGGAG	p.Ala678_Glu689del	conservative_inframe_deletion	Exon 1 of 1	NP_115511.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FSCB	ENST00000340446.5	TSL:6 MANE Select	c.2032_2067delGCCCCTGCTGAAGTTCAGTCTCTACCAGCTGAGGAG	p.Ala678_Glu689del	conservative_inframe_deletion	Exon 1 of 1	ENSP00000344579.4	Q5H9T9
	LINC02277	ENST00000557721.2	TSL:2	n.108-60134_108-60099delGCCCCTGCTGAAGTTCAGTCTCTACCAGCTGAGGAG		intron	N/A
	LINC02277	ENST00000795526.1		n.108-60134_108-60099delGCCCCTGCTGAAGTTCAGTCTCTACCAGCTGAGGAG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.00609 AC: 916 AN: 150492 Hom.: 47 Cov.: 32

Gnomad AFR AF: 0.0215

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00204

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00962

Gnomad NFE AF: 0.0000884

Gnomad OTH AF: 0.00483

GnomAD2 exomes AF: 0.000407 AC: 102 AN: 250524 AF XY: 0.000324

Gnomad AFR exome AF: 0.00548

Gnomad AMR exome AF: 0.000406

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000323 AC: 472 AN: 1461106 Hom.: 28 AF XY: 0.000272 AC XY: 198 AN XY: 726856

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0106 AC: 353 AN: 33290

American (AMR) AF: 0.000962 AC: 43 AN: 44684

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26124

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.0000232 AC: 2 AN: 86214

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00129 AC: 7 AN: 5428

European-Non Finnish (NFE) AF: 0.0000207 AC: 23 AN: 1111952

Other (OTH) AF: 0.000730 AC: 44 AN: 60296

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00610 AC: 918 AN: 150608 Hom.: 46 Cov.: 32 AF XY: 0.00592 AC XY: 436 AN XY: 73638

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0215 AC: 868 AN: 40394

American (AMR) AF: 0.00204 AC: 31 AN: 15204

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.00 AC: 0 AN: 5118

South Asian (SAS) AF: 0.00 AC: 0 AN: 4770

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10526

Middle Eastern (MID) AF: 0.0103 AC: 3 AN: 290

European-Non Finnish (NFE) AF: 0.0000884 AC: 6 AN: 67840

Other (OTH) AF: 0.00478 AC: 10 AN: 2094

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.000203 Hom.: 0

EpiCase AF: 0.000109

EpiControl AF: 0.0000593

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=194/6	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs866319674; hg19: chr14-44974123; COSMIC: COSV61219915; COSMIC: COSV61219915;