chr15-48467966-AGGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT-A

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000138.5(FBN1):​c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC​(p.Lys1559LeufsTer2) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

FBN1
NM_000138.5 frameshift

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 10.0

Publications

1 publications found
Variant links:
Genes affected
FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]
FBN1 Gene-Disease associations (from GenCC):
  • familial thoracic aortic aneurysm and aortic dissection
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • Marfan syndrome
    Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P, PanelApp Australia, Orphanet, Ambry Genetics
  • Acromicric dysplasia
    Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
  • progeroid and marfanoid aspect-lipodystrophy syndrome
    Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
  • stiff skin syndrome
    Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
  • Weill-Marchesani syndrome 2, dominant
    Inheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
  • geleophysic dysplasia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • isolated ectopia lentis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • neonatal Marfan syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Weill-Marchesani syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • ectopia lentis 1, isolated, autosomal dominant
    Inheritance: AD Classification: LIMITED Submitted by: G2P
  • Shprintzen-Goldberg syndrome
    Inheritance: AD, Unknown Classification: LIMITED, NO_KNOWN Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 15-48467966-AGGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT-A is Pathogenic according to our data. Variant chr15-48467966-AGGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 163474.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
FBN1NM_000138.5 linkc.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC p.Lys1559LeufsTer2 frameshift_variant Exon 38 of 66 ENST00000316623.10 NP_000129.3
FBN1NM_001406716.1 linkc.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC p.Lys1559LeufsTer2 frameshift_variant Exon 37 of 65 NP_001393645.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
FBN1ENST00000316623.10 linkc.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC p.Lys1559LeufsTer2 frameshift_variant Exon 38 of 66 1 NM_000138.5 ENSP00000325527.5

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Weill-Marchesani syndrome Pathogenic:1
Jan 29, 2016
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

proposed classification - variant undergoing re-assessment, contact laboratory

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
10
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs727503056; hg19: chr15-48760163; API