rs727503056

Variant names:

• chr15-48467966-AGGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT-A
• rs727503056
• NM_000138.5:c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000138.5(FBN1):​c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC​(p.Lys1559LeufsTer2) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: FBN1 NM_000138.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0
• Publications: 1 publications found

Genes affected

FBN1 (HGNC:3603): (fibrillin 1) This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. These microfibrils provide force-bearing structural support in elastic and nonelastic connective tissue throughout the body. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Mutations in this gene are associated with Marfan syndrome and the related MASS phenotype, as well as ectopia lentis syndrome, Weill-Marchesani syndrome, Shprintzen-Goldberg syndrome and neonatal progeroid syndrome. [provided by RefSeq, Apr 2016]

FBN1 Gene-Disease associations (from GenCC):

• familial thoracic aortic aneurysm and aortic dissection

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Marfan syndrome

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P, PanelApp Australia, Orphanet, Ambry Genetics
• Acromicric dysplasia

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
• progeroid and marfanoid aspect-lipodystrophy syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
• stiff skin syndrome

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• Weill-Marchesani syndrome 2, dominant

  Inheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• geleophysic dysplasia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated ectopia lentis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• neonatal Marfan syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Weill-Marchesani syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• ectopia lentis 1, isolated, autosomal dominant

  Inheritance: AD Classification: LIMITED Submitted by: G2P
• Shprintzen-Goldberg syndrome

  Inheritance: AD, Unknown Classification: LIMITED, NO_KNOWN Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 15-48467966-AGGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT-A is Pathogenic according to our data. Variant chr15-48467966-AGGAGTACCCCAGGCTTTACCCAGAGAACAGCAGCAGGAAGCTTT-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 163474.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FBN1	NM_000138.5	c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC	p.Lys1559LeufsTer2	frameshift_variant	Exon 38 of 66	ENST00000316623.10	NP_000129.3
FBN1	NM_001406716.1	c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC	p.Lys1559LeufsTer2	frameshift_variant	Exon 37 of 65		NP_001393645.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FBN1	ENST00000316623.10	c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC	p.Lys1559LeufsTer2	frameshift_variant	Exon 38 of 66	1	NM_000138.5	ENSP00000325527.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Weill-Marchesani syndrome Pathogenic:1

Jan 29, 2016

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

proposed classification - variant undergoing re-assessment, contact laboratory -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503056; hg19: chr15-48760163;