rs727503056
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000138.5(FBN1):c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC(p.Lys1559LeufsTer2) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay. The gene FBN1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000138.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- Marfan syndromeInheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet, Genomics England PanelApp
- familial thoracic aortic aneurysm and aortic dissectionInheritance: Unknown, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- Acromicric dysplasiaInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- progeroid and marfanoid aspect-lipodystrophy syndromeInheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
- stiff skin syndromeInheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- Weill-Marchesani syndrome 2, dominantInheritance: AD Classification: STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- geleophysic dysplasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- isolated ectopia lentisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- neonatal Marfan syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Weill-Marchesani syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- ectopia lentis 1, isolated, autosomal dominantInheritance: AD Classification: LIMITED Submitted by: G2P
- Shprintzen-Goldberg syndromeInheritance: Unknown, AD Classification: LIMITED, NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000138.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FBN1 | MANE Select | c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC | p.Lys1559LeufsTer2 | frameshift | Exon 38 of 66 | NP_000129.3 | |||
| FBN1 | c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC | p.Lys1559LeufsTer2 | frameshift | Exon 37 of 65 | NP_001393645.1 | P35555 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FBN1 | TSL:1 MANE Select | c.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC | p.Lys1559LeufsTer2 | frameshift | Exon 38 of 66 | ENSP00000325527.5 | P35555 | ||
| FBN1 | TSL:1 | n.4675_4718delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC | non_coding_transcript_exon | Exon 38 of 67 | ENSP00000453958.2 | H0YND0 | |||
| FBN1 | TSL:5 | n.*438_*481delAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCC | non_coding_transcript_exon | Exon 13 of 31 | ENSP00000440294.2 | F6U495 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at