chr16-3728629-G-GCAGGCTGGGCTGCTGGTGCATGC

Variant names:

• chr16-3728629-G-GCAGGCTGGGCTGCTGGTGCATGC
• rs797045500
• NM_004380.3:c.6395_6417dupGCATGCACCAGCAGCCCAGCCTG

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_004380.3(CREBBP):​c.6395_6417dupGCATGCACCAGCAGCCCAGCCTG​(p.Gln2140AlafsTer11) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L2139L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CREBBP NM_004380.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.41
• Publications: 1 publications found

Genes affected

CREBBP (HGNC:2348): (CREB binding protein) This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]

CREBBP Gene-Disease associations (from GenCC):

• Rubinstein-Taybi syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: Illumina, ClinGen
• Rubinstein-Taybi syndrome due to CREBBP mutations

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• Menke-Hennekam syndrome 1

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 6 pathogenic variants in the truncated region.
• PP5: Variant 16-3728629-G-GCAGGCTGGGCTGCTGGTGCATGC is Pathogenic according to our data. Variant chr16-3728629-G-GCAGGCTGGGCTGCTGGTGCATGC is described in ClinVar as Pathogenic. ClinVar VariationId is 210786.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004380.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CREBBP	NM_004380.3	MANE Select	c.6395_6417dupGCATGCACCAGCAGCCCAGCCTG	p.Gln2140AlafsTer11	frameshift	Exon 31 of 31	NP_004371.2	Q92793-1
	CREBBP	NM_001079846.1		c.6281_6303dupGCATGCACCAGCAGCCCAGCCTG	p.Gln2102AlafsTer11	frameshift	Exon 30 of 30	NP_001073315.1	Q92793-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CREBBP	ENST00000262367.10	TSL:1 MANE Select	c.6395_6417dupGCATGCACCAGCAGCCCAGCCTG	p.Gln2140AlafsTer11	frameshift	Exon 31 of 31	ENSP00000262367.5	Q92793-1
	CREBBP	ENST00000382070.7	TSL:1	c.6281_6303dupGCATGCACCAGCAGCCCAGCCTG	p.Gln2102AlafsTer11	frameshift	Exon 30 of 30	ENSP00000371502.3	Q92793-2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Rubinstein-Taybi syndrome due to CREBBP mutations (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045500; hg19: chr16-3778630;