chr19-38448512-GTCAGTGGGGTTTGTGGCGCCCTCCC-G

Variant names:

• chr19-38448512-GTCAGTGGGGTTTGTGGCGCCCTCCC-G
• rs794726982
• NM_000540.3:c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The ENST00000355481.8(RYR1):​c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC variant causes a splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000561 in 1,613,974 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). The gene RYR1 is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.00033 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00059 (0 hom.)
• Consequence: RYR1 ENST00000355481.8 splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:9
• Conservation: PhyloP100: 7.86
• Publications: 0 publications found

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 Gene-Disease associations (from GenCC):

• malignant hyperthermia, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, ClinGen
• RYR1-related myopathy

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
• congenital multicore myopathy with external ophthalmoplegia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• central core myopathy

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• King-Denborough syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant hyperthermia of anesthesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• benign Samaritan congenital myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• congenital myopathy with myasthenic-like onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for RYR1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000355481.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	NM_000540.3	MANE Select	c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA		splice_region intron	N/A	NP_000531.2	P21817-1
	RYR1	NM_001042723.2		c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA		splice_region intron	N/A	NP_001036188.1	P21817-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	ENST00000359596.8	TSL:5 MANE Select	c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC		splice_donor splice_region intron	N/A	ENSP00000352608.2	P21817-1
	RYR1	ENST00000355481.8	TSL:1	c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC		splice_donor splice_region intron	N/A	ENSP00000347667.3	P21817-2
	RYR1	ENST00000594335.6	TSL:1	n.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC		splice_donor splice_region intron	N/A	ENSP00000470927.2	M0R014

Frequencies

GnomAD3 genomes AF: 0.000329 AC: 50 AN: 152168 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000662

Gnomad OTH AF: 0.000479

GnomAD2 exomes AF: 0.000358 AC: 90 AN: 251206 AF XY: 0.000368

Gnomad AFR exome AF: 0.0000616

Gnomad AMR exome AF: 0.000636

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000463

Gnomad NFE exome AF: 0.000555

Gnomad OTH exome AF: 0.000489

GnomAD4 exome AF: 0.000586 AC: 856 AN: 1461806 Hom.: 0 AF XY: 0.000578 AC XY: 420 AN XY: 727200

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000896 AC: 3 AN: 33480

American (AMR) AF: 0.000581 AC: 26 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.0000937 AC: 5 AN: 53348

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.000716 AC: 796 AN: 1111996

Other (OTH) AF: 0.000430 AC: 26 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000329 AC: 50 AN: 152168 Hom.: 0 Cov.: 31 AF XY: 0.000242 AC XY: 18 AN XY: 74336

African (AFR) AF: 0.0000483 AC: 2 AN: 41434

American (AMR) AF: 0.000131 AC: 2 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5186

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.000662 AC: 45 AN: 68022

Other (OTH) AF: 0.000479 AC: 1 AN: 2088

Alfa AF: 0.000324 Hom.: 0

Bravo AF: 0.000317

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	5	-	not provided (5)
-	1	-	Malignant hyperthermia, susceptibility to, 1 (1)
-	1	-	Neuromuscular disease (1)
-	1	-	not specified (1)
-	1	-	RYR1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9
Mutation Taster		=77/23	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs794726982; hg19: chr19-38939152;