rs794726982
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The ENST00000355481.8(RYR1):c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC variant causes a splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000561 in 1,613,974 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). The gene RYR1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
ENST00000355481.8 splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, ClinGen
- RYR1-related myopathyInheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000355481.8. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RYR1 | TSL:5 MANE Select | c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC | splice_donor splice_region intron | N/A | ENSP00000352608.2 | P21817-1 | |||
| RYR1 | TSL:1 | c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC | splice_donor splice_region intron | N/A | ENSP00000347667.3 | P21817-2 | |||
| RYR1 | TSL:1 | n.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC | splice_donor splice_region intron | N/A | ENSP00000470927.2 | M0R014 |
Frequencies
GnomAD3 genomes AF: 0.000329 AC: 50AN: 152168Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.000358 AC: 90AN: 251206 AF XY: 0.000368 show subpopulations
GnomAD4 exome AF: 0.000586 AC: 856AN: 1461806Hom.: 0 AF XY: 0.000578 AC XY: 420AN XY: 727200 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.000329 AC: 50AN: 152168Hom.: 0 Cov.: 31 AF XY: 0.000242 AC XY: 18AN XY: 74336 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at