rs794726982

Variant names:

• chr19-38448512-GTCAGTGGGGTTTGTGGCGCCCTCCC-G
• rs794726982
• NM_000540.3:c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1

The ENST00000359596.8(RYR1):​c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC variant causes a splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000561 in 1,613,974 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.00033 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00059 (0 hom.)
• Consequence: RYR1 ENST00000359596.8 splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:8
• Conservation: PhyloP100: 7.86

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RYR1	NM_000540.3	c.957+5_957+29delGTGGGGTTTGTGGCGCCCTCCCTCA		splice_region_variant, intron_variant	Intron 10 of 105	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC		splice_donor_variant, splice_region_variant, intron_variant	Intron 10 of 105	5	NM_000540.3	ENSP00000352608.2
RYR1	ENST00000355481.8	c.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC		splice_donor_variant, splice_region_variant, intron_variant	Intron 10 of 104	1		ENSP00000347667.3
RYR1	ENST00000599547.6	n.957+2_957+26delTCAGTGGGGTTTGTGGCGCCCTCCC		splice_donor_variant, splice_region_variant, intron_variant	Intron 10 of 79	2		ENSP00000471601.2

Frequencies

GnomAD3 genomes AF: 0.000329 AC: 50 AN: 152168 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000662

Gnomad OTH AF: 0.000479

GnomAD3 exomes AF: 0.000358 AC: 90 AN: 251206 Hom.: 0 AF XY: 0.000368 AC XY: 50 AN XY: 135864

Gnomad AFR exome AF: 0.0000616

Gnomad AMR exome AF: 0.000636

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000463

Gnomad NFE exome AF: 0.000555

Gnomad OTH exome AF: 0.000489

GnomAD4 exome AF: 0.000586 AC: 856 AN: 1461806 Hom.: 0 AF XY: 0.000578 AC XY: 420 AN XY: 727200

Gnomad4 AFR exome AF: 0.0000896

Gnomad4 AMR exome AF: 0.000581

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000937

Gnomad4 NFE exome AF: 0.000716

Gnomad4 OTH exome AF: 0.000430

GnomAD4 genome AF: 0.000329 AC: 50 AN: 152168 Hom.: 0 Cov.: 31 AF XY: 0.000242 AC XY: 18 AN XY: 74336

Gnomad4 AFR AF: 0.0000483

Gnomad4 AMR AF: 0.000131

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000662

Gnomad4 OTH AF: 0.000479

Alfa AF: 0.000324 Hom.: 0

Bravo AF: 0.000317

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:8

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:4

Feb 03, 2016

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 24, 2023

Revvity Omics, Revvity

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 08, 2014

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 15, 2020

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Has not been previously published as pathogenic or benign to our knowledge; In silico analysis, which includes splice predictors and evolutionary conservation, supports a deleterious effect -

not specified Uncertain:1

Mar 28, 2016

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant identified in a genome or exome case(s) and assessed due to predicted null impact of the variant or pathogenic assertions in the literature or databases. Disclaimer: This variant has not undergone full assessment. The following are preliminary notes: Intronic deletion, possible weak splice impact; ExAC: 0.1% (12/11570) Latino chromosomes (does not pass quality filter) -

Neuromuscular disease Uncertain:1

Mar 27, 2022

Johns Hopkins Genomics, Johns Hopkins University

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This RYR1 variant (rs794726982) is rare (<0.1%) in a large population dataset (gnomAD: 102/282552 total alleles; 0.036%; no homozygotes) and has been reported in ClinVar. This variant has been reported in two family members with exertional myalgia and rhabdomyolysis. This 25 bp deletion* is located in the splice donor region of intron 10. Bioinformatic analysis predicts that this variant would affect RNA splicing, although this has not been confirmed experimentally to our knowledge. Due to insufficient evidence, we consider the clinical significance of c.957+5_957+29del to be uncertain at this time. -

Malignant hyperthermia, susceptibility to, 1 Uncertain:1

Jul 07, 2023

Molecular Genetics, Royal Melbourne Hospital

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change in RYR1 is an intronic variant located in intron 10. The highest population minor allele frequency in the population database gnomAD v2.1 is 0.06% (74/128,986 alleles) in the European (non-Finnish) population. This variant has been reported in at least two families with recurrent rhabdomyolysis, and segregates with rhabdomyolysis in one of these families (PMID: 23628358, 25960145). The results from an in silico splicing predictor (SpliceAI) indicate that this variant supports neither a deleterious nor benign impact on the donor splice site of intron 10 of RYR1. Based on the classification scheme RMH Modified ACMG Guidelines v1.6.1, this variant is classified as a VARIANT OF UNCERTAIN SIGNIFICANCE. Following criteria are met: none. -

RYR1-related disorder Uncertain:1

Jan 25, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change falls in intron 10 of the RYR1 gene. It does not directly change the encoded amino acid sequence of the RYR1 protein. It affects a nucleotide within the consensus splice site. This variant is present in population databases (rs752290298, gnomAD 0.06%). This variant has been observed in individual(s) with clinical features of autosomal recessive RYR1-related conditions (PMID: 23628358, 25960145, 37510298; internal data). ClinVar contains an entry for this variant (Variation ID: 193600). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs794726982; hg19: chr19-38939152;