chr19-38565561-C-CGAGGGCGCTGGAGACGCCGCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000540.3(RYR1):c.13244_13264dupCCGCGGAGGGCGCTGGAGACG(p.Ala4415_Asp4421dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000937 in 1,483,368 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000540.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- RYR1-related myopathyInheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| RYR1 | NM_000540.3 | c.13244_13264dupCCGCGGAGGGCGCTGGAGACG | p.Ala4415_Asp4421dup | disruptive_inframe_insertion | Exon 91 of 106 | ENST00000359596.8 | NP_000531.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| RYR1 | ENST00000359596.8 | c.13244_13264dupCCGCGGAGGGCGCTGGAGACG | p.Ala4415_Asp4421dup | disruptive_inframe_insertion | Exon 91 of 106 | 5 | NM_000540.3 | ENSP00000352608.2 |
Frequencies
GnomAD3 genomes AF: 0.0000790 AC: 12AN: 151962Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000117 AC: 1AN: 85708 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.0000954 AC: 127AN: 1331406Hom.: 0 Cov.: 31 AF XY: 0.000105 AC XY: 69AN XY: 656378 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000790 AC: 12AN: 151962Hom.: 0 Cov.: 32 AF XY: 0.0000539 AC XY: 4AN XY: 74212 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
RYR1-related disorder Uncertain:2
This variant, c.13244_13264dup, results in the insertion of 7 amino acid(s) to the RYR1 protein (p.Ala4415_Asp4421dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant has been observed in individual(s) with congenital myopathy (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
The RYR1 c.13244_13264dup21 variant is predicted to result in an in-frame duplication (p.Ala4415_Asp4421dup). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.0056% of alleles in individuals of Latino descent in gnomAD. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
not provided Uncertain:2
- -
In-frame duplication of 7 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -
not specified Uncertain:1
Variant summary: RYR1 c.13244_13264dup21 (p.Ala4415_Asp4421dup) results in an in-frame duplication that is predicted to duplicate 7 amino acids into the encoded protein. The variant allele was found at a frequency of 1.2e-05 in 85708 control chromosomes (gnomAD). The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.13244_13264dup21 in individuals affected with Myopathy, RYR1-Associated and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 287765). Based on the evidence outlined above, the variant was classified as uncertain significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at