chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC

Variant names:

• chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC
• rs1064792931
• NM_000465.4:c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000465.4(BARD1):​c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG​(p.Thr534AlafsTer6) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T534T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BARD1 NM_000465.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 5.92
• Publications: 2 publications found

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

BARD1 Gene-Disease associations (from GenCC):

• breast cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is Pathogenic according to our data. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in CliVar as Pathogenic. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BARD1	NM_000465.4	c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG	p.Thr534AlafsTer6	frameshift_variant, missense_variant	Exon 7 of 11	ENST00000260947.9	NP_000456.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BARD1	ENST00000260947.9	c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG	p.Thr534AlafsTer6	frameshift_variant, missense_variant	Exon 7 of 11	1	NM_000465.4	ENSP00000260947.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Familial cancer of breast Pathogenic:1

Sep 22, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in BARD1 are known to be pathogenic  (PMID: 21344236, 22006311, 20077502). This sequence change results in the deletion of 34 nucleotides and the insertion of 3 nucleotides in exon 7 of the BARD1 mRNA (c.1600_1634delinsGCG), causing a frameshift at codon 534. This creates a premature translational stop signal (p.Thr534Alafs*6) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792931; hg19: chr2-215617214;