chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000465.4(BARD1):​c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG​(p.Thr534AlafsTer6) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

BARD1
NM_000465.4 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 5.92
Variant links:
Genes affected
BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is Pathogenic according to our data. Variant chr2-214752490-AGCAGCAATAGCGATTTCATACTTTCATCATCTGT-CGC is described in ClinVar as [Pathogenic]. Clinvar id is 406768.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BARD1NM_000465.4 linkc.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG p.Thr534AlafsTer6 frameshift_variant, missense_variant Exon 7 of 11 ENST00000260947.9 NP_000456.2 Q99728-1A0AVN2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BARD1ENST00000260947.9 linkc.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG p.Thr534AlafsTer6 frameshift_variant, missense_variant Exon 7 of 11 1 NM_000465.4 ENSP00000260947.4 Q99728-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial cancer of breast Pathogenic:1
Sep 22, 2016
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in BARD1 are known to be pathogenic  (PMID: 21344236, 22006311, 20077502). This sequence change results in the deletion of 34 nucleotides and the insertion of 3 nucleotides in exon 7 of the BARD1 mRNA (c.1600_1634delinsGCG), causing a frameshift at codon 534. This creates a premature translational stop signal (p.Thr534Alafs*6) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1064792931; hg19: chr2-215617214; API