rs1064792931
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000465.4(BARD1):c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG(p.Thr534AlafsTer6) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T534T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000465.4 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- BARD1-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- hereditary breast carcinomaInheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- familial ovarian cancerInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000465.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | MANE Select | c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG | p.Thr534AlafsTer6 | frameshift missense | Exon 7 of 11 | NP_000456.2 | Q99728-1 | ||
| BARD1 | c.1543_1577delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG | p.Thr515AlafsTer6 | frameshift missense | Exon 6 of 10 | NP_001269472.1 | Q99728-2 | |||
| BARD1 | c.247_281delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG | p.Thr83AlafsTer6 | frameshift missense | Exon 3 of 7 | NP_001269474.1 | C9IYG1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | TSL:1 MANE Select | c.1600_1634delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG | p.Thr534AlafsTer6 | frameshift missense | Exon 7 of 11 | ENSP00000260947.4 | Q99728-1 | ||
| BARD1 | TSL:1 | c.1543_1577delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG | p.Thr515AlafsTer6 | frameshift missense | Exon 6 of 10 | ENSP00000480470.1 | Q99728-2 | ||
| BARD1 | TSL:1 | c.1192_1226delACAGATGATGAAAGTATGAAATCGCTATTGCTGCTinsGCG | p.Thr398AlafsTer6 | frameshift missense | Exon 7 of 11 | ENSP00000484976.2 | A0A087X2H0 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.