chr2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000251.3(MSH2):c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG(p.His46fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 33)
Consequence
MSH2
NM_000251.3 frameshift
NM_000251.3 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 8.54
Genes affected
MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G is Pathogenic according to our data. Variant chr2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 90639.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MSH2 | NM_000251.3 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46fs | frameshift_variant | 1/16 | ENST00000233146.7 | NP_000242.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MSH2 | ENST00000233146.7 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46fs | frameshift_variant | 1/16 | 1 | NM_000251.3 | ENSP00000233146.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: reviewed by expert panel
LINK: link
Submissions by phenotype
Carcinoma of colon Pathogenic:1
Pathogenic, no assertion criteria provided | clinical testing | Department of Pathology and Laboratory Medicine, Sinai Health System | - | The p.His46GlyfsX26 deletion has been previously reported in the literature in individuals with Lynch syndrome (Selected publications: Casey 2005, Choi 2009). This deletion is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 46 and leads to a premature stop 26 codons downstream. This alteration is predicted to lead to a truncated or absent protein product and loss of function. Loss of function variants are an established disease mechanism for the MSH2 gene and is the type of alteration expected to cause Lynch syndrome. In summary, based on the above information, this variant is classified as pathogenic. - |
Lynch syndrome 1 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Myriad Genetics, Inc. | Jul 26, 2023 | This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. - |
Lynch syndrome Pathogenic:1
Pathogenic, reviewed by expert panel | research | International Society for Gastrointestinal Hereditary Tumours (InSiGHT) | Sep 05, 2013 | Coding sequence variation introducing premature termination codon - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at