chr2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000251.3(MSH2):c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG(p.His46GlyfsTer26) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. H46H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000251.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000251.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | NM_000251.3 | MANE Select | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 16 | NP_000242.1 | ||
| MSH2 | NM_001406674.1 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 18 | NP_001393603.1 | |||
| MSH2 | NM_001406631.1 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 18 | NP_001393560.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | ENST00000233146.7 | TSL:1 MANE Select | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 16 | ENSP00000233146.2 | ||
| MSH2 | ENST00000406134.5 | TSL:1 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 16 | ENSP00000384199.1 | ||
| MSH2 | ENST00000645506.1 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 17 | ENSP00000495455.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Carcinoma of colon Pathogenic:1
The p.His46GlyfsX26 deletion has been previously reported in the literature in individuals with Lynch syndrome (Selected publications: Casey 2005, Choi 2009). This deletion is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 46 and leads to a premature stop 26 codons downstream. This alteration is predicted to lead to a truncated or absent protein product and loss of function. Loss of function variants are an established disease mechanism for the MSH2 gene and is the type of alteration expected to cause Lynch syndrome. In summary, based on the above information, this variant is classified as pathogenic.
Lynch syndrome 1 Pathogenic:1
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
Lynch syndrome Pathogenic:1
Coding sequence variation introducing premature termination codon
Muir-Torré syndrome;C2936783:Lynch syndrome 1;C5436806:Mismatch repair cancer syndrome 2 Pathogenic:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at