rs63751482

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000251.3(MSH2):​c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG​(p.His46GlyfsTer26) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. H46H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

MSH2
NM_000251.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:4

Conservation

PhyloP100: 8.54

Publications

5 publications found
Variant links:
Genes affected
MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
MSH2 Gene-Disease associations (from GenCC):
  • Lynch syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
  • Lynch syndrome 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
  • Muir-Torre syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
  • mismatch repair cancer syndrome 1
    Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • mismatch repair cancer syndrome 2
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
  • ovarian cancer
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • malignant pancreatic neoplasm
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • prostate cancer
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • rhabdomyosarcoma
    Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
  • breast cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G is Pathogenic according to our data. Variant chr2-47403324-GCGCACGGCGAGGACGCGCTGCTGGCCGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 90639.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH2NM_000251.3 linkc.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG p.His46GlyfsTer26 frameshift_variant Exon 1 of 16 ENST00000233146.7 NP_000242.1 P43246-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH2ENST00000233146.7 linkc.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG p.His46GlyfsTer26 frameshift_variant Exon 1 of 16 1 NM_000251.3 ENSP00000233146.2 P43246-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:4
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Carcinoma of colon Pathogenic:1
-
Department of Pathology and Laboratory Medicine, Sinai Health System
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:clinical testing

The p.His46GlyfsX26 deletion has been previously reported in the literature in individuals with Lynch syndrome (Selected publications: Casey 2005, Choi 2009). This deletion is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 46 and leads to a premature stop 26 codons downstream. This alteration is predicted to lead to a truncated or absent protein product and loss of function. Loss of function variants are an established disease mechanism for the MSH2 gene and is the type of alteration expected to cause Lynch syndrome. In summary, based on the above information, this variant is classified as pathogenic. -

Lynch syndrome 1 Pathogenic:1
Jul 26, 2023
Myriad Genetics, Inc.
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Lynch syndrome Pathogenic:1
Sep 05, 2013
International Society for Gastrointestinal Hereditary Tumours (InSiGHT)
Significance:Pathogenic
Review Status:reviewed by expert panel
Collection Method:research

Coding sequence variation introducing premature termination codon -

Muir-Torré syndrome;C2936783:Lynch syndrome 1;C5436806:Mismatch repair cancer syndrome 2 Pathogenic:1
Oct 25, 2012
Department of Pathology and Laboratory Medicine, Sinai Health System
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.5
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs63751482; hg19: chr2-47630463; API