chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G

Position:

• chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G

Variant summary

Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_006031.6(PCNT):​c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC​(p.His156_Gln168del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.018 in 141,884 control chromosomes in the GnomAD database, including 103 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.018 (103 hom., cov: 33)
  • Exomes 𝑓: 0.011 (476 hom.)
  • Failed GnomAD Quality Control
• Consequence: PCNT NM_006031.6 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 1.24

Genes affected

PCNT (HGNC:16068): (pericentrin) The protein encoded by this gene binds to calmodulin and is expressed in the centrosome. It is an integral component of the pericentriolar material (PCM). The protein contains a series of coiled-coil domains and a highly conserved PCM targeting motif called the PACT domain near its C-terminus. The protein interacts with the microtubule nucleation component gamma-tubulin and is likely important to normal functioning of the centrosomes, cytoskeleton, and cell-cycle progression. Mutations in this gene cause Seckel syndrome-4 and microcephalic osteodysplastic primordial dwarfism type II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

PCNT (HGNC:):

ACMG classification

Verdict is Benign. Variant got -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006031.6.
• BP6: Variant 21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G is Benign according to our data. Variant chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G is described in ClinVar as [Likely_benign]. Clinvar id is 159609.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G is described in Lovd as [Likely_benign]. Variant chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G is described in Lovd as [Likely_benign].
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.018 (2549/141884) while in subpopulation NFE AF= 0.0295 (1891/64172). AF 95% confidence interval is 0.0284. There are 103 homozygotes in gnomad4. There are 1147 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 103 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PCNT	NM_006031.6	c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168del	disruptive_inframe_deletion	3/47	ENST00000359568.10	NP_006022.3
PCNT	NM_001315529.2	c.113_151delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His38_Gln50del	disruptive_inframe_deletion	3/47		NP_001302458.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PCNT	ENST00000359568.10	c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168del	disruptive_inframe_deletion	3/47	1	NM_006031.6	ENSP00000352572.5

Frequencies

GnomAD3 genomes AF: 0.0180 AC: 2548 AN: 141764 Hom.: 103 Cov.: 33

Gnomad AFR AF: 0.00599

Gnomad AMI AF: 0.00225

Gnomad AMR AF: 0.0177

Gnomad ASJ AF: 0.00754

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.00109

Gnomad FIN AF: 0.0109

Gnomad MID AF: 0.00658

Gnomad NFE AF: 0.0295

Gnomad OTH AF: 0.0197

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0106 AC: 14627 AN: 1376768 Hom.: 476 AF XY: 0.0108 AC XY: 7379 AN XY: 685088

Gnomad4 AFR exome AF: 0.00251

Gnomad4 AMR exome AF: 0.00820

Gnomad4 ASJ exome AF: 0.0101

Gnomad4 EAS exome AF: 0.000305

Gnomad4 SAS exome AF: 0.00151

Gnomad4 FIN exome AF: 0.0144

Gnomad4 NFE exome AF: 0.0117

Gnomad4 OTH exome AF: 0.0143

GnomAD4 genome AF: 0.0180 AC: 2549 AN: 141884 Hom.: 103 Cov.: 33 AF XY: 0.0166 AC XY: 1147 AN XY: 69254

Gnomad4 AFR AF: 0.00597

Gnomad4 AMR AF: 0.0177

Gnomad4 ASJ AF: 0.00754

Gnomad4 EAS AF: 0.000195

Gnomad4 SAS AF: 0.00109

Gnomad4 FIN AF: 0.0109

Gnomad4 NFE AF: 0.0295

Gnomad4 OTH AF: 0.0195

Alfa AF: 0.0157 Hom.: 30

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 31, 2024	- -
Benign, criteria provided, single submitter	clinical testing	GeneDx	May 26, 2020	- -

Microcephalic osteodysplastic primordial dwarfism type II Benign:2

Likely benign, criteria provided, single submitter	clinical testing	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	Feb 22, 2017	- -
Likely benign, no assertion criteria provided	clinical testing	Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen	-	- -

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Nov 13, 2013

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587784306; hg19: chr21-47754471;