rs587784306

Variant names:

• chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G
• rs587784306
• NM_006031.6:c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC

Your query was ambiguous. Multiple possible variants found:

• chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G
• chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA

Variant summary

Our verdict is Benign. The variant received -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BS1 BS2

The NM_006031.6(PCNT):​c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC​(p.His156_Gln168del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.018 in 141,884 control chromosomes in the GnomAD database, including 103 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.018 (103 hom., cov: 33)
  • Exomes 𝑓: 0.011 (476 hom.)
  • Failed GnomAD Quality Control
• Consequence: PCNT NM_006031.6 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:7
• Conservation: PhyloP100: 1.24
• Publications: 1 publications found

Genes affected

PCNT (HGNC:16068): (pericentrin) The protein encoded by this gene binds to calmodulin and is expressed in the centrosome. It is an integral component of the pericentriolar material (PCM). The protein contains a series of coiled-coil domains and a highly conserved PCM targeting motif called the PACT domain near its C-terminus. The protein interacts with the microtubule nucleation component gamma-tubulin and is likely important to normal functioning of the centrosomes, cytoskeleton, and cell-cycle progression. Mutations in this gene cause Seckel syndrome-4 and microcephalic osteodysplastic primordial dwarfism type II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

PCNT Gene-Disease associations (from GenCC):

• microcephalic osteodysplastic primordial dwarfism type II

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P, Orphanet
• Moyamoya disease

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Benign. The variant received -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006031.6.
• BP6: Variant 21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G is Benign according to our data. Variant chr21-46334557-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA-G is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 159609.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.018 (2549/141884) while in subpopulation NFE AF = 0.0295 (1891/64172). AF 95% confidence interval is 0.0284. There are 103 homozygotes in GnomAd4. There are 1147 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 103 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006031.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PCNT	NM_006031.6	MANE Select	c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168del	disruptive_inframe_deletion	Exon 3 of 47	NP_006022.3
	PCNT	NM_001315529.2		c.113_151delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His38_Gln50del	disruptive_inframe_deletion	Exon 3 of 47	NP_001302458.1	O95613-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PCNT	ENST00000359568.10	TSL:1 MANE Select	c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168del	disruptive_inframe_deletion	Exon 3 of 47	ENSP00000352572.5	O95613-1
	PCNT	ENST00000480896.5	TSL:1	c.113_151delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His38_Gln50del	disruptive_inframe_deletion	Exon 3 of 47	ENSP00000511989.1	O95613-2
	PCNT	ENST00000695558.1		c.467_505delATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168del	disruptive_inframe_deletion	Exon 3 of 48	ENSP00000512015.1	A0A8Q3SHZ3

Frequencies

GnomAD3 genomes AF: 0.0180 AC: 2548 AN: 141764 Hom.: 103 Cov.: 33

Gnomad AFR AF: 0.00599

Gnomad AMI AF: 0.00225

Gnomad AMR AF: 0.0177

Gnomad ASJ AF: 0.00754

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.00109

Gnomad FIN AF: 0.0109

Gnomad MID AF: 0.00658

Gnomad NFE AF: 0.0295

Gnomad OTH AF: 0.0197

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0106 AC: 14627 AN: 1376768 Hom.: 476 AF XY: 0.0108 AC XY: 7379 AN XY: 685088

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00251 AC: 76 AN: 30232

American (AMR) AF: 0.00820 AC: 349 AN: 42536

Ashkenazi Jewish (ASJ) AF: 0.0101 AC: 247 AN: 24546

East Asian (EAS) AF: 0.000305 AC: 12 AN: 39372

South Asian (SAS) AF: 0.00151 AC: 122 AN: 81030

European-Finnish (FIN) AF: 0.0144 AC: 728 AN: 50604

Middle Eastern (MID) AF: 0.00350 AC: 19 AN: 5430

European-Non Finnish (NFE) AF: 0.0117 AC: 12253 AN: 1045708

Other (OTH) AF: 0.0143 AC: 821 AN: 57310

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0180 AC: 2549 AN: 141884 Hom.: 103 Cov.: 33 AF XY: 0.0166 AC XY: 1147 AN XY: 69254

African (AFR) AF: 0.00597 AC: 223 AN: 37332

American (AMR) AF: 0.0177 AC: 254 AN: 14346

Ashkenazi Jewish (ASJ) AF: 0.00754 AC: 25 AN: 3316

East Asian (EAS) AF: 0.000195 AC: 1 AN: 5130

South Asian (SAS) AF: 0.00109 AC: 5 AN: 4600

European-Finnish (FIN) AF: 0.0109 AC: 108 AN: 9870

Middle Eastern (MID) AF: 0.00709 AC: 2 AN: 282

European-Non Finnish (NFE) AF: 0.0295 AC: 1891 AN: 64172

Other (OTH) AF: 0.0195 AC: 38 AN: 1948

Alfa AF: 0.0157 Hom.: 30

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	3	not provided (3)
-	-	2	Microcephalic osteodysplastic primordial dwarfism type II (2)
-	-	2	not specified (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2
Mutation Taster		=133/67	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587784306; hg19: chr21-47754471;