chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PP5_Moderate
The NM_000551.4(VHL):c.-78_-58delGCGCGCACGCAGCTCCGCCCC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_000551.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
VHL | NM_000551.4 | c.-78_-58delGCGCGCACGCAGCTCCGCCCC | 5_prime_UTR_variant | Exon 1 of 3 | ENST00000256474.3 | NP_000542.1 | ||
VHL | NM_000551.4 | c.-78_-58delGCGCGCACGCAGCTCCGCCCC | non_coding_transcript_variant | ENST00000256474.3 | NP_000542.1 | |||
VHL | NM_000551.4 | c.-78_-58delGCGCGCACGCAGCTCCGCCCC | upstream_gene_variant | ENST00000256474.3 | NP_000542.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
VHL | ENST00000256474 | c.-78_-58delGCGCGCACGCAGCTCCGCCCC | 5_prime_UTR_variant | Exon 1 of 3 | 1 | NM_000551.4 | ENSP00000256474.3 | |||
VHL | ENST00000256474.3 | c.-78_-58delGCGCGCACGCAGCTCCGCCCC | non_coding_transcript_variant | 1 | NM_000551.4 | ENSP00000256474.3 | ||||
VHL | ENST00000256474.3 | c.-78_-58delGCGCGCACGCAGCTCCGCCCC | upstream_gene_variant | 1 | NM_000551.4 | ENSP00000256474.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Von Hippel-Lindau syndrome Pathogenic:1
The c.-75_-55del variant in VHL has been identified by our laboratory in 1 Cauca sian adult with VHL and segregated with disease in at least 5 affected relatives including 1 obligate carrier. This variant is located in the 5' untranslated re gion (UTR), a regulatory region, and may have an effect on translational efficie ncy. The deleted sequence in this variant is highly conserved in evolutionarily distant species and in vitro studies have shown that a deletion of this region r emoves a transcription factor binding site which is predicted to alter VHL trans cription (Zatyka 2002). In summary, although additional studies are required to fully establish its clinical significance, the c.-75_-55del variant is likely pa thogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at