chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PP5_Moderate

The NM_000551.4(VHL):​c.-78_-58delGCGCGCACGCAGCTCCGCCCC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 33)

Consequence

VHL
NM_000551.4 5_prime_UTR

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 3.83
Variant links:
Genes affected
VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is Pathogenic according to our data. Variant chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 166561.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
VHLNM_000551.4 linkc.-78_-58delGCGCGCACGCAGCTCCGCCCC 5_prime_UTR_variant Exon 1 of 3 ENST00000256474.3 NP_000542.1 P40337-1A0A024R2F2
VHLNM_000551.4 linkc.-78_-58delGCGCGCACGCAGCTCCGCCCC non_coding_transcript_variant ENST00000256474.3 NP_000542.1 P40337-1A0A024R2F2
VHLNM_000551.4 linkc.-78_-58delGCGCGCACGCAGCTCCGCCCC upstream_gene_variant ENST00000256474.3 NP_000542.1 P40337-1A0A024R2F2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
VHLENST00000256474 linkc.-78_-58delGCGCGCACGCAGCTCCGCCCC 5_prime_UTR_variant Exon 1 of 3 1 NM_000551.4 ENSP00000256474.3 P40337-1
VHLENST00000256474.3 linkc.-78_-58delGCGCGCACGCAGCTCCGCCCC non_coding_transcript_variant 1 NM_000551.4 ENSP00000256474.3 P40337-1
VHLENST00000256474.3 linkc.-78_-58delGCGCGCACGCAGCTCCGCCCC upstream_gene_variant 1 NM_000551.4 ENSP00000256474.3 P40337-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Von Hippel-Lindau syndrome Pathogenic:1
Dec 09, 2014
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.-75_-55del variant in VHL has been identified by our laboratory in 1 Cauca sian adult with VHL and segregated with disease in at least 5 affected relatives including 1 obligate carrier. This variant is located in the 5' untranslated re gion (UTR), a regulatory region, and may have an effect on translational efficie ncy. The deleted sequence in this variant is highly conserved in evolutionarily distant species and in vitro studies have shown that a deletion of this region r emoves a transcription factor binding site which is predicted to alter VHL trans cription (Zatyka 2002). In summary, although additional studies are required to fully establish its clinical significance, the c.-75_-55del variant is likely pa thogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs727503744; hg19: chr3-10183453; API