rs727503744

Variant names:

• chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A
• rs727503744
• NM_000551.4:c.-78_-58delGCGCGCACGCAGCTCCGCCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong

The NM_000551.4(VHL):​c.-78_-58delGCGCGCACGCAGCTCCGCCCC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 3.83
• Publications: 1 publications found

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL Gene-Disease associations (from GenCC):

• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• von Hippel-Lindau disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P, Orphanet
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal recessive secondary polycythemia not associated with VHL gene

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Chuvash polycythemia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP5: Variant 3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is Pathogenic according to our data. Variant chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 166561.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VHL	NM_000551.4	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR_variant	Exon 1 of 3	ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		non_coding_transcript_variant		ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		upstream_gene_variant		ENST00000256474.3	NP_000542.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474.3	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR_variant	Exon 1 of 3	1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		non_coding_transcript_variant		1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		upstream_gene_variant		1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Von Hippel-Lindau syndrome Pathogenic:2

Dec 09, 2014

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.-75_-55del variant in VHL has been identified by our laboratory in 1 Cauca sian adult with VHL and segregated with disease in at least 5 affected relatives including 1 obligate carrier. This variant is located in the 5' untranslated re gion (UTR), a regulatory region, and may have an effect on translational efficie ncy. The deleted sequence in this variant is highly conserved in evolutionarily distant species and in vitro studies have shown that a deletion of this region r emoves a transcription factor binding site which is predicted to alter VHL trans cription (Zatyka 2002). In summary, although additional studies are required to fully establish its clinical significance, the c.-75_-55del variant is likely pa thogenic. -

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:1

May 28, 2025

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.-75_-55del21 variant is located in the 5' untranslated region (5'UTR) of the VHL gene. This variant results from a deletion of 21 nucleotides at positions c.-75 to c.-55. This variant was reported in individuals with features consistent with von Hippel-Lindau syndrome and segregated with disease in at least one family (Ambry internal data, external communication). This variant deletes a region of the VHL promoter that is predicted to be critical for VHL transcription and protein expression (Zatyka M et al. J Med Genet, 2002 Jul;39:463-72). Other variants impacting the same region have been identified in individuals with features consistent with von Hippel-Lindau syndrome (Albanyan S et al. Eur J Med Genet, 2019 Mar;62:177-181). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503744; hg19: chr3-10183453;