rs727503744

Variant names:

• chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A
• rs727503744
• NM_000551.4:c.-78_-58delGCGCGCACGCAGCTCCGCCCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PP5_Moderate

The NM_000551.4(VHL):​c.-78_-58delGCGCGCACGCAGCTCCGCCCC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.83

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is Pathogenic according to our data. Variant chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 166561.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VHL	NM_000551.4	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR_variant	Exon 1 of 3	ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		non_coding_transcript_variant		ENST00000256474.3	NP_000542.1
VHL	NM_000551.4	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		upstream_gene_variant		ENST00000256474.3	NP_000542.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR_variant	Exon 1 of 3	1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		non_coding_transcript_variant		1	NM_000551.4	ENSP00000256474.3
VHL	ENST00000256474.3	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		upstream_gene_variant		1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Von Hippel-Lindau syndrome Pathogenic:1

Dec 09, 2014

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.-75_-55del variant in VHL has been identified by our laboratory in 1 Cauca sian adult with VHL and segregated with disease in at least 5 affected relatives including 1 obligate carrier. This variant is located in the 5' untranslated re gion (UTR), a regulatory region, and may have an effect on translational efficie ncy. The deleted sequence in this variant is highly conserved in evolutionarily distant species and in vitro studies have shown that a deletion of this region r emoves a transcription factor binding site which is predicted to alter VHL trans cription (Zatyka 2002). In summary, although additional studies are required to fully establish its clinical significance, the c.-75_-55del variant is likely pa thogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs727503744; hg19: chr3-10183453;