chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C

Variant names:

• chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C
• rs1553776036
• NM_174878.3:c.188_210delACGGGCTTTTCCACGGAGAGGGT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_174878.3(CLRN1):​c.188_210delACGGGCTTTTCCACGGAGAGGGT​(p.Tyr63CysfsTer59) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. Y63Y) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CLRN1 NM_174878.3 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 7.42
• Publications: 1 publications found

Genes affected

CLRN1 (HGNC:12605): (clarin 1) This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

ENSG00000243273 (HGNC:):

SIAH2-AS1 (HGNC:40526): (SIAH2 antisense RNA 1)

CLRN1-AS1 (HGNC:30895): (CLRN1 antisense RNA 1)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is Pathogenic according to our data. Variant chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 4398.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_174878.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLRN1	NM_174878.3	MANE Select	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63CysfsTer59	frameshift	Exon 1 of 3	NP_777367.1
	CLRN1	NM_001195794.1		c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63CysfsTer59	frameshift	Exon 1 of 4	NP_001182723.1
	CLRN1	NM_001256819.2		c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63CysfsTer19	frameshift	Exon 1 of 4	NP_001243748.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLRN1	ENST00000327047.6	TSL:1 MANE Select	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63CysfsTer59	frameshift	Exon 1 of 3	ENSP00000322280.1
	CLRN1	ENST00000328863.8	TSL:1	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63CysfsTer59	frameshift	Exon 1 of 4	ENSP00000329158.4
	CLRN1	ENST00000468836.2	TSL:3	c.164_186delACGGGCTTTTCCACGGAGAGGGT	p.Tyr55CysfsTer19	frameshift	Exon 1 of 4	ENSP00000419892.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
2	-	-	Usher syndrome type 3 (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553776036; hg19: chr3-150690285;