rs1553776036

Positions:

• chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_174878.3(CLRN1):​c.188_210delACGGGCTTTTCCACGGAGAGGGT​(p.Tyr63fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CLRN1 NM_174878.3 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 7.42

Genes affected

CLRN1 (HGNC:12605): (clarin 1) This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

CLRN1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is Pathogenic according to our data. Variant chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is described in ClinVar as [Pathogenic]. Clinvar id is 4398.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CLRN1	NM_174878.3	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63fs	frameshift_variant	1/3	ENST00000327047.6	NP_777367.1
CLRN1	NM_001195794.1	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63fs	frameshift_variant	1/4		NP_001182723.1
CLRN1	NM_001256819.2	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63fs	frameshift_variant	1/4		NP_001243748.1
CLRN1	NR_046380.3	n.207_229delACGGGCTTTTCCACGGAGAGGGT		non_coding_transcript_exon_variant	1/5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CLRN1	ENST00000327047.6	c.188_210delACGGGCTTTTCCACGGAGAGGGT	p.Tyr63fs	frameshift_variant	1/3	1	NM_174878.3	ENSP00000322280.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Usher syndrome type 3 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jun 01, 2002

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553776036; hg19: chr3-150690285;