chr5-132390906-TAGGGACCATGTGCATCTATGG-T

Variant names:

• chr5-132390906-TAGGGACCATGTGCATCTATGG-T
• rs386134216
• NM_003060.4:c.1267+3_1267+23delAGGGACCATGTGCATCTATGG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000245407.8(SLC22A5):​c.1267+3_1267+23delAGGGACCATGTGCATCTATGG variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 33)
• Consequence: SLC22A5 ENST00000245407.8 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 7.37
• Publications: 2 publications found

Genes affected

SLC22A5 (HGNC:10969): (solute carrier family 22 member 5) Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]

SLC22A5 Gene-Disease associations (from GenCC):

• systemic primary carnitine deficiency disease

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Orphanet, PanelApp Australia, Labcorp Genetics (formerly Invitae), Myriad Women’s Health
• short QT syndrome

  Inheritance: AR Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000245407.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC22A5	NM_003060.4	MANE Select	c.1267+3_1267+23delAGGGACCATGTGCATCTATGG		splice_region intron	N/A	NP_003051.1
	SLC22A5	NM_001308122.2		c.1339+3_1339+23delAGGGACCATGTGCATCTATGG		splice_region intron	N/A	NP_001295051.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC22A5	ENST00000245407.8	TSL:1 MANE Select	c.1267+3_1267+23delAGGGACCATGTGCATCTATGG		splice_region intron	N/A	ENSP00000245407.3
	SLC22A5	ENST00000435065.7	TSL:1	c.1339+3_1339+23delAGGGACCATGTGCATCTATGG		splice_region intron	N/A	ENSP00000402760.2
	SLC22A5	ENST00000448810.6	TSL:1	n.*119+3_*119+23delAGGGACCATGTGCATCTATGG		splice_region intron	N/A	ENSP00000401860.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4
Mutation Taster		=4/96	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs386134216; hg19: chr5-131726598;