rs386134216
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_003060.4(SLC22A5):c.1267+3_1267+23delAGGGACCATGTGCATCTATGG variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_003060.4 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- systemic primary carnitine deficiency diseaseInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet, G2P, ClinGen
- short QT syndromeInheritance: AR Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003060.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC22A5 | TSL:1 MANE Select | c.1267+3_1267+23delAGGGACCATGTGCATCTATGG | splice_region intron | N/A | ENSP00000245407.3 | O76082-1 | |||
| SLC22A5 | TSL:1 | c.1339+3_1339+23delAGGGACCATGTGCATCTATGG | splice_region intron | N/A | ENSP00000402760.2 | O76082-3 | |||
| SLC22A5 | TSL:1 | n.*119+3_*119+23delAGGGACCATGTGCATCTATGG | splice_region intron | N/A | ENSP00000401860.2 | H7C1R8 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at