chr7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1PM4PP5_Very_Strong
The NM_000492.4(CFTR):c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA(p.Val1022_Gln1039del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. V1022V) has been classified as Likely benign.
Frequency
Consequence
NM_000492.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- cystic fibrosisInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
- congenital bilateral absence of vas deferensInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary chronic pancreatitisInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CFTR | NM_000492.4 | c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA | p.Val1022_Gln1039del | conservative_inframe_deletion | Exon 19 of 27 | ENST00000003084.11 | NP_000483.3 | |
| CFTR-AS2 | NR_199597.1 | n.177+5583_178-5604delTGCTGTGAGGTTTGGAGGAAATATGCTCTCAACATAATAAAAGCCACTATCACT | intron_variant | Intron 2 of 2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CFTR | ENST00000003084.11 | c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA | p.Val1022_Gln1039del | conservative_inframe_deletion | Exon 19 of 27 | 1 | NM_000492.4 | ENSP00000003084.6 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Cystic fibrosis Pathogenic:3Other:1
This variant, c.3064_3117del, results in the deletion of 18 amino acid(s) of the CFTR protein (p.Val1022_Gln1039del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with cystic fibrosis (PMID: 8880589). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53645). This variant disrupts a region of the CFTR protein in which other variant(s) (p.Ile1023_Val1024del) have been determined to be pathogenic (PMID: 7516234, 12394343, 15287992, 22020151, 22627569). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
- -
- -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at