rs1554392027
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PM1PM2PM4PP5_Very_Strong
The NM_000492.4(CFTR):c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA(p.Val1022_Gln1039del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Genomes: not found (cov: 31)
Consequence
CFTR
NM_000492.4 conservative_inframe_deletion
NM_000492.4 conservative_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 5.95
Genes affected
CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 14 ACMG points.
PM1
In a domain ABC transmembrane type-1 2 (size 296) in uniprot entity CFTR_HUMAN there are 53 pathogenic changes around while only 8 benign (87%) in NM_000492.4
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000492.4.
PP5
Variant 7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C is Pathogenic according to our data. Variant chr7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 53645.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CFTR | NM_000492.4 | c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA | p.Val1022_Gln1039del | conservative_inframe_deletion | 19/27 | ENST00000003084.11 | NP_000483.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CFTR | ENST00000003084.11 | c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA | p.Val1022_Gln1039del | conservative_inframe_deletion | 19/27 | 1 | NM_000492.4 | ENSP00000003084.6 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 31
GnomAD4 genome
Cov.:
31
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Cystic fibrosis Pathogenic:3Other:1
Pathogenic, criteria provided, single submitter | curation | CFTR-France | Jan 29, 2018 | - - |
not provided, no classification provided | literature only | ClinVar Staff, National Center for Biotechnology Information (NCBI) | - | - - |
Likely pathogenic, criteria provided, single submitter | research | Division of Human Genetics, National Health Laboratory Service/University of the Witwatersrand | Jul 01, 2023 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Sep 21, 2023 | This variant, c.3064_3117del, results in the deletion of 18 amino acid(s) of the CFTR protein (p.Val1022_Gln1039del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with cystic fibrosis (PMID: 8880589). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53645). This variant disrupts a region of the CFTR protein in which other variant(s) (p.Ile1023_Val1024del) have been determined to be pathogenic (PMID: 7516234, 12394343, 15287992, 22020151, 22627569). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at