rs1554392027

Variant names:

• chr7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C
• rs1554392027
• NM_000492.4:c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PM1 PM2 PM4 PP5_Very_Strong

The NM_000492.4(CFTR):​c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA​(p.Val1022_Gln1039del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: CFTR NM_000492.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3 O:1
• Conservation: PhyloP100: 5.95

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

ENSG00000083622 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PM1: In a domain ABC transmembrane type-1 2 (size 296) in uniprot entity CFTR_HUMAN there are 53 pathogenic changes around while only 8 benign (87%) in NM_000492.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000492.4.
• PP5: Variant 7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C is Pathogenic according to our data. Variant chr7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 53645.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFTR	NM_000492.4	c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA	p.Val1022_Gln1039del	conservative_inframe_deletion	Exon 19 of 27	ENST00000003084.11	NP_000483.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA	p.Val1022_Gln1039del	conservative_inframe_deletion	Exon 19 of 27	1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Cystic fibrosis Pathogenic:3 Other:1

Jan 29, 2018

CFTR-France

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Sep 21, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.3064_3117del, results in the deletion of 18 amino acid(s) of the CFTR protein (p.Val1022_Gln1039del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with cystic fibrosis (PMID: 8880589). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53645). This variant disrupts a region of the CFTR protein in which other variant(s) (p.Ile1023_Val1024del) have been determined to be pathogenic (PMID: 7516234, 12394343, 15287992, 22020151, 22627569). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Jul 01, 2023

Division of Human Genetics, National Health Laboratory Service/University of the Witwatersrand

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

-

ClinVar Staff, National Center for Biotechnology Information (NCBI)

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554392027; hg19: chr7-117250646;