chr7-150947352-TCCAGCCTGCTCTCCACGTCGC-T
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000238.4(KCNH2):c.3107_3127delGCGACGTGGAGAGCAGGCTGG(p.Gly1036_Leu1042del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000238.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
KCNH2 | NM_000238.4 | c.3107_3127delGCGACGTGGAGAGCAGGCTGG | p.Gly1036_Leu1042del | disruptive_inframe_deletion | Exon 13 of 15 | ENST00000262186.10 | NP_000229.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
KCNH2 | ENST00000262186.10 | c.3107_3127delGCGACGTGGAGAGCAGGCTGG | p.Gly1036_Leu1042del | disruptive_inframe_deletion | Exon 13 of 15 | 1 | NM_000238.4 | ENSP00000262186.5 | ||
KCNH2 | ENST00000330883.9 | c.2087_2107delGCGACGTGGAGAGCAGGCTGG | p.Gly696_Leu702del | disruptive_inframe_deletion | Exon 9 of 11 | 1 | ENSP00000328531.4 | |||
KCNH2 | ENST00000684241.1 | n.3940_3960delGCGACGTGGAGAGCAGGCTGG | non_coding_transcript_exon_variant | Exon 11 of 13 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Long QT syndrome Uncertain:1
In summary, this variant is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a KCNH2-related disease. This sequence change deletes 21 nucleotides from exon 13 of the KCNH2 mRNA (c.3107_3127del). This leads to the deletion of 7 amino acid residues in the KCNH2 protein (p.Gly1036_Leu1042del) but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at