rs1064792917
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_000238.4(KCNH2):c.3107_3127delGCGACGTGGAGAGCAGGCTGG(p.Gly1036_Leu1042del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G1036G) has been classified as Likely benign.
Frequency
Consequence
NM_000238.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- long QT syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- long QT syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- short QT syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- short QT syndrome type 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
- Brugada syndromeInheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000238.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNH2 | MANE Select | c.3107_3127delGCGACGTGGAGAGCAGGCTGG | p.Gly1036_Leu1042del | disruptive_inframe_deletion | Exon 13 of 15 | NP_000229.1 | A0A090N8Q0 | ||
| KCNH2 | c.2819_2839delGCGACGTGGAGAGCAGGCTGG | p.Gly940_Leu946del | disruptive_inframe_deletion | Exon 11 of 13 | NP_001393682.1 | Q12809-7 | |||
| KCNH2 | c.2087_2107delGCGACGTGGAGAGCAGGCTGG | p.Gly696_Leu702del | disruptive_inframe_deletion | Exon 9 of 11 | NP_742054.1 | Q12809-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNH2 | TSL:1 MANE Select | c.3107_3127delGCGACGTGGAGAGCAGGCTGG | p.Gly1036_Leu1042del | disruptive_inframe_deletion | Exon 13 of 15 | ENSP00000262186.5 | Q12809-1 | ||
| KCNH2 | TSL:1 | c.2087_2107delGCGACGTGGAGAGCAGGCTGG | p.Gly696_Leu702del | disruptive_inframe_deletion | Exon 9 of 11 | ENSP00000328531.4 | Q12809-2 | ||
| KCNH2 | c.3041_3061delGCGACGTGGAGAGCAGGCTGG | p.Gly1014_Leu1020del | disruptive_inframe_deletion | Exon 13 of 15 | ENSP00000519013.1 | A0AAQ5BGR0 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at