rs1064792917

Variant names:

• chr7-150947352-TCCAGCCTGCTCTCCACGTCGC-T
• rs1064792917
• NM_000238.4:c.3107_3127delGCGACGTGGAGAGCAGGCTGG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_000238.4(KCNH2):​c.3107_3127delGCGACGTGGAGAGCAGGCTGG​(p.Gly1036_Leu1042del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G1036G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 7.24
• Publications: 0 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 5 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 28 uncertain in NM_000238.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000238.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.3107_3127delGCGACGTGGAGAGCAGGCTGG	p.Gly1036_Leu1042del	disruptive_inframe_deletion	Exon 13 of 15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.3107_3127delGCGACGTGGAGAGCAGGCTGG	p.Gly1036_Leu1042del	disruptive_inframe_deletion	Exon 13 of 15	1	NM_000238.4	ENSP00000262186.5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Long QT syndrome Uncertain:1

Mar 18, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, this variant is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a KCNH2-related disease. This sequence change deletes 21 nucleotides from exon 13 of the KCNH2 mRNA (c.3107_3127del). This leads to the deletion of 7 amino acid residues in the KCNH2 protein (p.Gly1036_Leu1042del) but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792917; hg19: chr7-150644440;