chr7-44145133-CTCTCACTGGCCCAGCATACAGG-C

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM2_SupportingPVS1

This summary comes from the ClinGen Evidence Repository: The c.1379_*2del variant in the glucokinase gene, GCK, causes a frameshift in the protein at codon 460 (NM_000162.5), causing a deletion of amino acids 26-265 and adding 146 novel amino acids before encountering a stop codon (p.(p.Ala460_Gln465delins146)). This variant, located in exon 10 of 10, is predicted to cause loss of a stop codon and result in an elongated protein. The additional residues are expected to cause improper folding, resulting in loss of function in a gene in which loss-of-function is an established disease mechanism (PVS1; PMID 19790256). This variant is absent in gnomAD v2.1.1 (PM2_Supporting), and was identified in one individual with non-autoimmune and non-absolute/near-absolute insulin-deficient diabetes. However, PS4_Moderate cannot be applied because this number is below the ClinGen MDEP threshold (internal lab contributor). Insufficient clinical information was available to evaluate for PP4. This variant segregated with diabetes with one informative meiosis in this individual's family; however, this does not meet the thresholds for PP1 set by the ClinGen MDEP (PMID:27236918, internal lab contributor). In summary, c.1379_*2del meets the criteria to be classified as likely pathogenic for monogenic diabetes. ACMG/AMP criteria applied, as specified by the ClinGen MDEP (specification version 1.2, approved 6/7/2023): PVS1, PM2_Supporting. LINK:https://erepo.genome.network/evrepo/ui/classification/CA2497028747/MONDO:0015967/086

Frequency

Genomes: not found (cov: 33)

Consequence

GCK
NM_000162.5 frameshift, stop_lost

Scores

Not classified

Clinical Significance

Likely pathogenic reviewed by expert panel P:1

Conservation

PhyloP100: 5.86
Variant links:
Genes affected
GCK (HGNC:4195): (glucokinase) This gene encodes a member of the hexokinase family of proteins. Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. The use of multiple promoters and alternative splicing of this gene result in distinct protein isoforms that exhibit tissue-specific expression in the pancreas and liver. In the pancreas, this enzyme plays a role in glucose-stimulated insulin secretion, while in the liver, this enzyme is important in glucose uptake and conversion to glycogen. Mutations in this gene that alter enzyme activity have been associated with multiple types of diabetes and hyperinsulinemic hypoglycemia. [provided by RefSeq, Aug 2017]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

PVS1
For more information check the summary or visit ClinGen Evidence Repository.
PM2
For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
GCKNM_000162.5 linkuse as main transcriptc.1379_*2delCCTGTATGCTGGGCCAGTGAGA p.Ala460fs frameshift_variant, stop_lost 10/10 ENST00000403799.8 NP_000153.1 P35557-1Q53Y25
GCKNM_000162.5 linkuse as main transcriptc.1378_*2delCCTGTATGCTGGGCCAGTGAGA 3_prime_UTR_variant 10/10 ENST00000403799.8 NP_000153.1 P35557-1Q53Y25

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
GCKENST00000403799.8 linkuse as main transcriptc.1379_*2delCCTGTATGCTGGGCCAGTGAGA p.Ala460fs frameshift_variant, stop_lost 10/101 NM_000162.5 ENSP00000384247.3 P35557-1
GCKENST00000403799 linkuse as main transcriptc.1378_*2delCCTGTATGCTGGGCCAGTGAGA 3_prime_UTR_variant 10/101 NM_000162.5 ENSP00000384247.3 P35557-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Monogenic diabetes Pathogenic:1
Likely pathogenic, reviewed by expert panelcurationClinGen Monogenic Diabetes Variant Curation Expert PanelJun 18, 2023The c.1379_*2del variant in the glucokinase gene, GCK, causes a frameshift in the protein at codon 460 (NM_000162.5), causing a deletion of amino acids 26-265 and adding 146 novel amino acids before encountering a stop codon (p.(p.Ala460_Gln465delins146)). This variant, located in exon 10 of 10, is predicted to cause loss of a stop codon and result in an elongated protein. The additional residues are expected to cause improper folding, resulting in loss of function in a gene in which loss-of-function is an established disease mechanism (PVS1; PMID 19790256). This variant is absent in gnomAD v2.1.1 (PM2_Supporting), and was identified in one individual with non-autoimmune and non-absolute/near-absolute insulin-deficient diabetes. However, PS4_Moderate cannot be applied because this number is below the ClinGen MDEP threshold (internal lab contributor). Insufficient clinical information was available to evaluate for PP4. This variant segregated with diabetes with one informative meiosis in this individual's family; however, this does not meet the thresholds for PP1 set by the ClinGen MDEP (PMID: 27236918, internal lab contributor). In summary, c.1379_*2del meets the criteria to be classified as likely pathogenic for monogenic diabetes. ACMG/AMP criteria applied, as specified by the ClinGen MDEP (specification version 1.2, approved 6/7/2023): PVS1, PM2_Supporting. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-44184732; API