chr9-128190776-GCTGCTGGAGCTGCTGCTGCTGTAA-G
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_001131016.2(CIZ1):c.58_81delTTACAGCAGCAGCAGCTCCAGCAG(p.Leu20_Gln27del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000305 in 1,539,472 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001131016.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- dystonia 23Inheritance: Unknown Classification: MODERATE Submitted by: Genomics England PanelApp
- inherited dystoniaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001131016.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CIZ1 | MANE Select | c.58_81delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu20_Gln27del | conservative_inframe_deletion | Exon 2 of 17 | NP_001124488.1 | Q9ULV3-1 | ||
| CIZ1 | c.148_171delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu50_Gln57del | conservative_inframe_deletion | Exon 2 of 18 | NP_001244904.1 | F5H2X7 | |||
| CIZ1 | c.58_81delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu20_Gln27del | conservative_inframe_deletion | Exon 2 of 17 | NP_036259.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CIZ1 | TSL:1 MANE Select | c.58_81delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu20_Gln27del | conservative_inframe_deletion | Exon 2 of 17 | ENSP00000362029.5 | Q9ULV3-1 | ||
| CIZ1 | TSL:1 | c.58_81delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu20_Gln27del | conservative_inframe_deletion | Exon 2 of 17 | ENSP00000362045.1 | Q9ULV3-3 | ||
| CIZ1 | TSL:2 | c.148_171delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu50_Gln57del | conservative_inframe_deletion | Exon 2 of 18 | ENSP00000439244.2 | F5H2X7 |
Frequencies
GnomAD3 genomes AF: 0.0000329 AC: 5AN: 151978Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.0000403 AC: 6AN: 148858 AF XY: 0.0000380 show subpopulations
GnomAD4 exome AF: 0.0000303 AC: 42AN: 1387494Hom.: 0 AF XY: 0.0000380 AC XY: 26AN XY: 684860 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000329 AC: 5AN: 151978Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1AN XY: 74210 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at